"Заметки" "Старина" Архивы Авторы Темы Гостевая Форумы Киоск Ссылки Начало

 

ЗАМЕТКИ ПО ЕВРЕЙСКОЙ ИСТОРИИ
ЕВРЕЙСКАЯ СТАРИНА

Заметки по еврейской истории

ГОСТЕВАЯ КНИГА
Спасибо за участие в форуме. Будем рады, если Вы добавите свое сообщение!
Пожалуйста, воздерживайтесь от высказываний, могущих оскорбить других людей!
Адрес редакции redaktor@berkovich-zametki.com

Обновлен книжный киоск нашего сетевого портала  >>>   Вышли из печати новые выпуски "Старины"





Ontario14 - Буквоеду
- Wednesday, February 28, 2007 at 15:54:58 (PST)

Буквоед
- Wednesday, February 28, 2007 at 05:58:11 (PST)
А что Ваша страховая компания говорит? ... "Нам растираться не к чему"

*****

Not my fault.
Лечусь "Crown Royal" - rye canadian whiskey. Рекомендую Вам, и Игреку тоже.


Жизель Дыряшкина, техник строительстватехник строительства
- Wednesday, February 28, 2007 at 14:39:34 (PST)

По поводу и в связи с поучениями

Приехавшие на международную книжную ярмарку, проходившую в Иерусалиме с 19 по 23 февраля, маститые российские писатели порадовали своих почитателей интересными, свежими и незаурядными мыслями. Правда, не все, но некоторые.
Так, Дмитрий Быков отметил, что создание Израиля было роковой ошибкой, что он, как и когда-то Пастернак, совсем, упаси Бог, не относит себя, невзирая на мать, к евреям. А этих последних, как он считает, надо держать равномерно по миру до полной и окончательной ассимиляции. Таков их путь на ближайшие хоть тысячу лет во времени и «на край земли, хоть за край», как мне подумалось, в пространстве.
А Людмила Улицкая нашла себя, оказалось, не в капусте, как все нормальные люди её возраста, а в православии. Вот, как говорится, век живи, век учись ... Но умирать дурой?! Ни за что! А потому и пишу всё это.
Со слов отче-видцев зафиксировала сама.

Дмитрию Быкову, често сказать, коров бы гонять по Рязани. Ан нет - потянуло писать и летать, летать не куда-то, а страшно сказать: помимо приличных названий, намазался он и в Израиль. Писавши ЖД , он всё время мечтал приехать в ЖД и устроить кагал – конечно, не так, как бывало, но чтобы вся пресса писала. Ведь нету кагала – прощай тиражи, квартира и дача в Рублёвке – всё это сокрыто в ЖДовке.
Приехал, скагалил, и цели достиг: одни лишь теперь разговоры про мысли гостящей особы. «Была это глупость – Израиль создать среди «коренных населений». Но коль не создали б, куда вам тикать, когда надоест неЖД вас читать, когда вместо премий, наград мишуры – падут тиражи, и следы нищеты напомнят, что было недавно?
Когда расползлась на кусочки страна, когда нехватало бумаги не только на книги – на зад протереть, когда с гонорара – не то, что поесть, поср...ть - и того нехватало. Тогда кто как мог, вспоминал, что еврей, что надо убраться как можно скорей подальше от мати – Россиии – хоть в Сша, хоть сюда, в Израили. Не было ошибкой в ЖД прибежать, что можно – забрать, а что купят – продать, и так просидеть лихолетье, тянувшееся десятилетье. Тогда не «ошибкой» считали страну, чей паспорт страховочной сеткой «героям» служил и дороги открыл для долгих гуляний по миру всему.
Поевши, попивши, дождались когда, ещё до поры «флогистона» , на нефть сумасшедше полезла цена, а с нею той нефти хозяйка - страна, которая супердержавой была, точнее, лишь то, что осталось, пошла и поехала процветать, давая охочим писать – пописать, имеющих чем – их труды покупать, и всем полагать, что возможно опять учить как когда-то, что лучше писать и читать и считать – никто и нигде не умеет. Теперь уж не надо на хлеб собирать, нормально - кормившую руку – кусать, икру можно есть, кое–чем запивать, а значит возникла возможность опять весь окружающий мир поучать, что он не есть мир, но огромный сортир, без капельки утонченья, лишь в силу предназначенья.
Но право учить сродни праву лечить – даётся оно не нахрапом, не верой пустою в своё первенство, а опытом, знаньем, уменьем. Как ладен совет – не смог сделать – учи, тому, что не знаешь, не можешь. Ведь это прекрасное свойство души – увидел соринку другого, и без остановки клейми и круши, бревна не заметив родного.
Как ладно, приехав за стол и под кров, хозяина тут же укорить: «Зачем же ты здесь, если Я – и не здесь, и было бы лучше тебе пересесть с насеста, на мой взгляд – чужого, на то, что меня и тебя породнит, на базе наречья родного. А коль не готов ты – стремглав и - назад, я всем расскажу, что ты полный дурак, и славу пущу, по всем странам бредя, сколь глуп ты в своём поведеньи за зря. Ведь ясно, как дважды четыре, что жизнь лишь в ремонте квартиры. В твоём захолустье где ж евроремонт, тусовка с полночи, бомонд и Литфонд? Что, нету? Понятное дело – судьба у тебя захерела.
Вот твой президент как насильник пойдёт в тюрьму и под знойное небо, а Наш в это время хвалу и почёт воздал нам, писателям, зрело. Он перед поездкой к тебе в Израиль нас всех на беседу к себе пригласил, и каждому до глубины прояснил – ЖД – это сложное дело. Его указанья – советы – достоин ты выслушать это?! Твоим же властям на тебя наплевать – езжай – не езжай, приезжай, уезжай... Тут просто подохнешь со скуки – где всё направляющи руки?!»
По мнению Быкова глупо вполне терпеть этот самый Израиль. Евреи – что соль, и по супу везде должны быть рассыпаны налегке, по крупочке, но не в комке торчать на печаль арабину. Ему коренному, с вогонищем прав –страдать вообще не по чину. Они, эта соль, понемногу везде пускай разъедают народы, и каждый по вкусу оставит себе, с учётом терпенья и моды.
«Изрядно достал всех Израиль – проект, ООН – поспешил, в том признаться не грех. Пора прекратить церемоньи. Закрыть и почистить – забыв вновь открыть»,- совет от гостя заездного, сердечное дру’гово слово. Однако не рано ль читаемый гость придумал решенье такое? Конечно, сторонников много найдёт сей кладезь идей и свежайший подход, но только продумал ли строго сам автор дорогу отхода?
Ведь, хочешь – не хочешь – вертится земля и может вернуться, что было вчера. Куда же тогда для спасенья – от страха и огорченья? Израиль полезно, Димок, сохранить, в него не плевать, ведь захочется пить... С твоею, дружище мой, рожей, народ, я надеюсь, лишь часть от него, но всё же захочет - построже. Тому ты примеров найдёшь не один – хоть вспомни свой нудный на телеке бой, где мальчик Леонтьев игрался тобой. Нашёл у народа поддержку? Наврядли. Скорее насмешку. К тому ж твой Леонтьев – он тоже ЖД, полезно бы помнить ему и тебе, что главное – не торопиться, но место иметь, куда смыться.
В компании с Быковым – много ЖД, на все направления хватких. Уменье предвидеть покоя исток – главнейшая их добродетель. Что делать – ошибка – поступкам сестра. Есть драма в надежде защиты. Вчера то членство в КПСС, сегодня – с крестищем на шее спокойней оно и вернее. Хотя, как сказать, но повешенный крест – есть право на выезд, но не на въезд, а именно этого права творящим всегда нехватало.

PS Пост - скриптом отвечу на внятный вопрос: зачем и с какой это стати, ты форму такую избрала письма – ведь то не любови посланье, а требованье перевоспитанья. Отвечу как есть, ничего не тая, ну просто, как в исповедальне – хотелось использовать метод его, героя повествованья.
За годы последние, раз этак пять открыть «Огонёк» доводилось – и в номере каждом встречала – единственное что поражало. То были написанные стихом, и с хохотом, и со стенаньем, запоминающиеся целиком, быковские бичеванья.

****

1)Д. Быков ЖД десять лет сочинял, но выпустил в свет лишь недавно. Шесть сотен страниц он поклонникам дал, но вовсе не мало обратно он взял. В труде своём мира судьбу описал, ну если не мира, так части. Той части, что меньше остатка раз в шесть - была, а затем – поужалась. Но ей, в дополненье, усильем пера, героем та часть мира стала, что хоть неприлично размером мала, шум миру привносит немалый.
В чём смысл у названия книги – ЖД? Ответ может дать и читатель. Конечно, не в память о КВЖД, а что-то другое, чего не прочесть в томах БСЭ, что на даче. Свобода додумать у каждого есть, то так посчитай, то иначе примерь. Но мнение автора – эти ЖД есть души живые, которых не верь. Вот так, ну а можно иначе ...
2) И даже Татьяна Толстая слиняла, в процессе стеная.
3) Энергии вид, что согласно ЖД, заменит привычные виды. Имея, богатым становишься в миг, а нет, - геть в рабы и не пикай.

Иерусалим



Б.Тененбаум - Игреку
- Wednesday, February 28, 2007 at 13:16:07 (PST)

У Меца там был один пассаж, связанный с нашим братом :) Оказывается, в то время в Египте была большая нужда в "белых" евнухах. "Черных" делали из рабов, привезенных, так сказать, с локальных рынков, а вот где было брать белых ? Войны с византийцами в это время стали давать негативные результаты, а одна Армения не поставляла достаtочного количества. Оказывается, рабов привозили тюрки, которые брали их в тех краях, где в дальнейшем образуется Россия. А евреи в Египте были презираемым племенем, которому поручалась всякая неприятная работа, вроде закапывания мертвечины и убирания нечистых животных вроде бродячих собак. Но - будучи народом Книги - евреи Египта через поколение-другое стали лучшими врачами страны. Поэтому тонкую операцию холощения поручали именно им. Торговая цепочка работала так - тюрки брали пленных, продавали их итальянцам на Черном Море, те привозили рабов в Александрию или Смирну, ну а дальше - как придется. Мать одного из фатимидских халифов была слaвянка, другого - негритянка. Мец использовал эти примеры для иллюстрации положения мусульманского права, по которому потомство целиком зависит от отца, а "женщина - только посредник".


Игрек
- Wednesday, February 28, 2007 at 12:52:36 (PST)

Б. Тененбауму

По поводу мусульманского ренессанса позволю себе цитату из "себя любимого", что само по себе цитата из Эллы.

"Кордова, VIII-XIII века.

Место рождения Сенеки и Моисея Маймонида в средние века было известно каждому образованному человеку. Кордова, основанная во втором веке до нашей эры, была важным центром различных римских и после римских провинций. В 711 году, владевшие Испанией визиготы (германские варвары, принявшие христианство в 587 году), попросили арабов- мусульман Северной Африки помочь подавить серьезное восстание испанской знати в Толедо. Мусульмане пришли, сделали свое дело, но уходить не захотели. В этом же году они разбили армию визиготов и захватили примерно половину Пиренейского полуострова. (Эта, совершенно неожиданно возникшая исламская «заноза», торчала в теле христианской Европы около 800 лет). С самого начала мусульманского вторжения и вплоть до 1069 гогда Кордова была столицей сначала эмирата, а потом огромного «андалузского» халифата. В X веке Кордова становится крупнейшим городом всей Западной Европы, уступая по размеру, но не по значению, только восточному Константинополю. В X-XII веках культурное главенство Кордовы не оспаривалось никем. При населении до 500 тысяч человек, в городе было более 2000 мечетей, 27 бесплатных школ, крупнейший в Европе университет, несколько обсерваторий и невероятное количество библиотек, в которых насчитывалось до 400 тысяч (!) книг. Крупнейшие ученые, математики, астрономы, врачи и философы средневековья – представители всех трех религий – жили в мире и дружбе под, как мы бы сказали, «мудрым руководством» сменяющих друг друга мусульманских правителей. Именно здесь выдающийся арабский философ XII века Аверроэс (Ибн Рушд) перевел и прокомментировал неизвестного христианам Аристотеля.
В ходе христианской Реконкисты, в 1236 году, Кордова была захвачена кастильским королем Фердинандом III, после чего почти мгновенно превратилась в незначительный провинциальный город.


Библиофил
- Wednesday, February 28, 2007 at 12:28:53 (PST)

Буквоед - Б. Тененбауму
- Wednesday, February 28, 2007 at 12:20:04 (PST)
Было бы интересно обсудить вопрос о "концентрации гениев" в одном географическом месте в какой-то один исторический период.

Об этом немного сказано у А. Ф. Лосева, в частности, в его "Эстетике Возрождения".
Есть об этом и у Дж. Тойнби.


Б.Тененбаум - Буквоеду
- Wednesday, February 28, 2007 at 12:28:43 (PST)

В СССР когда-то издали интересную переводную кнгу Адама Меца, "Мусульманский Ренессанс". Автор доказывал, что страны Ислама пережили свой "золотой век" в десятом-одиннадцатом веке.


Б.Тененбаум - М.Тартаковскому, по поводу Нефертити :)
- Wednesday, February 28, 2007 at 12:24:57 (PST)

Я не поленился и посмотрел ваше сочинение в номерах 3 и 4 "Старины". Вы трудный автор - в том смысле, что цепочкa доказательств обычно отсутствуeт, а лирические отступления обильны :) Поэтому найти раздел o Нефертити оказалось непросто. Но я его нашел. Доказательств вашего предположения о том, что Нефертити родом из племени Иакова, нет никаких. Есть ваше предположение, основанное на "... необычайной духовности отношений фараона Эхнатона со своей супругой ..." - это все. Все-таки гипотезы, особенно такие смелые, надо бы на чем-то базировать ?

Если я что-то недосмотрел в вашей статье и обоснование там все-таки есть - пожалуйста, поправьте меня.


Буквоед - Б. Тененбауму
- Wednesday, February 28, 2007 at 12:20:04 (PST)

Было бы интересно обсудить вопрос о "концентрации гениев" в одном географическом месте в какой-то один исторический период.
---
Меня это тоже занимает. XIX век - плеяда великих русских писателей, великих немецких философов. Италия XIV - XVI веков - созвездие величайших имен во всех областях. Чем это вызвано, с чем связано?
****
О "золотом веке" различных культур все-таки не зря говорят. Солнце Ренессанса - уж простите мне такое пышное выражение - взошло в Италии, и понемногу двигалось на Север - во Францию, в Германию, в Англию. Как это получилось, и почему только в Европе ?
---
Наверное, и скорее всего, "золотой век" был и в Индии, и в Китае, и в Японии, просто, страны эти были настолько "закрыты" в силу очень многих причин, что мы не очень-то и знаем об этом. Мусульманский мир имел свой "золотой век": Хайям, Авиценна...Кроме того, эстетическое восприятие у людей разных культур тоже, наверное, разное... Что до Нового Света, то публика, которая туда попала, начиная от конкистадоров и кончая голытьбой из местечек "черты оседлости" или из сицилийских деревень, думала не о Ренессансе, о более приземленных вещах?



Б.Тененбаум - Е.Берковичу, Матроскину, Игреку
- Wednesday, February 28, 2007 at 11:18:25 (PST)

У меня после первого путешествия по Италии - сразу из СССР, совершенно без денег, но зато с широко открытым от изумления ртом - осталось впечатление, несколько напоминающее Ваше "красивая женщина, позволяющая себе выглядеть по домашнему". Но Флоренция при этом была "дамой из общества", а Венеция - "дамой полусвета" :)

Что, конечно, совершенно субьективно ...

Было бы интересно обсудить вопрос о "концентрации гениев" в одном географическом месте в какой-то один исторический период. О "золотом веке" различных культур все-таки не зря говорят. Солнце Ренессанса - уж простите мне такое пышное выражение - взошло в Италии, и понемногу двигалось на Север - во Францию, в Германию, в Англию. Как это получилось, и почему только в Европе ? Институт Экспериментальной Истории все еще не открыт, да и теория Истории, увы, не слишком разработана :)


Матроскин
- Wednesday, February 28, 2007 at 10:57:18 (PST)

Евгений Беркович
- Wednesday, February 28, 2007 at 09:53:58 (PST)
... не участвовал в интересном обсуждении Венеции и других итальянских городов. По поводу первого впечатления, которая она оставляет на туристов своей неприбранностью и запущенностью: она напоминает красивую женщину, которая может позволить себе выйти к гостю по-домашнему. И гость через минуту забудет про все, очарованный и побежденный.

Существует множество старинных городов, и Венеция отнюдь не самый старший из них. Над моим столом висит большое фото, которое я назвал "Агония". Узкий внецианский канал-улица в обрамлении невероятно обшарпанных когда-то цветных зданий. Метрах в 80 виден горбатый мостик. По правой стороне канальчика стоит несколько лодок. В воде отражается небо, подчеркивая мелкую рябь.

Все это не столько колоритные старческие морщины, сколько болезненное преждевременное одряхление. И это справедливо для всего центра города. При этом в Венеции сконцентрировано огромное количество разнообразнейших шедевров. В лучшем случае транспортабельная часть коллекции в ближайшем будущем уйдет в запасники на неопределенное время. А все эти разнообразнейшие палаццо, дворцы и соборы просто обречены. В Сан Марко пол так выпучен в местах опоры на сваи, что ходить по нему совершенно невозможно, и потрясающая мозаика уже безвозвратно испорчена. Фасадная стена отвалилась от поперечных стен и удерживается только стальными струнами...

А Флоренция живет и здравствует, хотя там тоже живут безалаберные итальянцы.


Евгений Беркович
- Wednesday, February 28, 2007 at 09:53:58 (PST)

Занят завершением мартовских "Заметок", которые должны скоро появиться на свет, поэтому не участвовал в интересном обсуждении Венеции и других итальянских городов. По поводу первого впечатления, которая она оставляет на туристов своей неприбранностью и запущенностью: она напоминает красивую женщину, которая может позволить себе выйти к гостю по-домашнему. И гость через минуту забудет про все, очарованный и побежденный.
Как Борис Тененбаум:

И тут случилось два события подряд - мы неожиданно вышли на площадь у Дворца Дожей, и из туч выглянуло солнце - море, простор, слегка восточный дворец, сильно похожий на картинку из сказки ! Впечатление было оглушительным - и незабываемым по сей день.


Удачи и следите за нашими объявлениями.


Тартаковский.
- Wednesday, February 28, 2007 at 09:48:29 (PST)


Матроскин - Тартаковскому
- Tuesday, February 27, 2007 at 12:24:49 (PST)
«Эрудит» Тартаковский.
Есть несколько исключительно простых вопросов:
1) Евреи в соответствии с Торой провели в Египте 430 лет. За это время произошло всего лишь около 28 000 извержений вулканов. Почему КОНКРЕТНО! извержение Тэры (а не «Тира») является «уникальным»?
2) С каких пор Эгейское море является «замкнутым бассейном»?
3) Почему именно извержение Тэры «запечатлелся в народной памяти»?
4) В каких бессмертных произведениях «эрудита» Тартаковского имеются КОНКРЕТНЫЕ ответы на эти вопросы?

>>>>>>>>>>>>>>>>>>>>>>VCT<<<<<<<<<<<<<<<<<<<<<<<<<<

Вопросы, действительно, настолько простые, что и в википедиях об этом ничего нет..
У нашего фигуранта есть, наконец, возможность самостоятельно подумать. Ну, как?
Перечислять бессмертные произведения не стоит. Всё уже им прочитано.



Матроскин
- Wednesday, February 28, 2007 at 09:11:44 (PST)


The Times
28 февраля 2007

Витаминные добавки "повышают коэффициент смертности на 5%"
Найджел Хокс

Витамины в таблетках, которые принимают миллионы людей, причиняют им больше вреда, чем пользы, показали результаты исследования.

http://inopressa.ru/times/2007/02/28/15:40:29/vitamins


Буквоед - Ольге Левин
- Wednesday, February 28, 2007 at 09:03:59 (PST)

Уважаемая г-жа Левин!
Разрешите мне как буквоеду поправить Вас. Слово "гой" все-таки имеет налет оскорбительности, поэтому, например, евреи в странах английского языка используют слова "Gentile" или "non-Jew" - здесь примерная аналогия со словом "жид", которое из названия еврея стало оскорбительным в русском языке. Теперь относительно Троцкого. Не совсем понятен Ваш тезис о том, что "длинная рука Сталина и здесь бы его достала". Г-н Чусов просто говорил, что для Троцкого Палестина была бы слишком маленькой, как и для Наполеона - Корсика. Сравнение же Троцкого с Наполеоном ничуть не унижает евреев, просто оно не совсем точное: Льва Давидовича, скорее, надо сравнивать с Лазаром Карно, "организатором победы" в войнах Великой французской революции. Кроме того, если исходить из того, что "у нас был свой военный командир- Иосиф Трумпендор" (я надеюсь, что Вы имели в виду Иосифа Трумпельдора), то мы не должны гордиться нашими дорогими фронтовиками: они ведь тоже в сталинской армии сражались, так по-Вашему получается? Наконец, о том, что "сестра Вашей жены соблазнила еврея". Это, конечно, дело г-на Чусова, но уж очень напоминает разговоры "с обратным знаком", о том, как евреи якобы совращали "арийских" женщин, а еврейки якобы соблазняли не-евреев для своих целей.
Вы уж меня извините, но какой-то нехороший осадок от Вашего постинга у меня остался.



АЕД
- Wednesday, February 28, 2007 at 08:23:15 (PST)

Не думаю, что сочетание "Ольга Левина" очень распространено. Поэтому задаю вопрос. В своё время в Минске проживала Ольга Левина, которая завоевала звание чемпионки мира по 100-клеткам. Это не Вы?


Ольга Левин
Натания, Израиль - Wednesday, February 28, 2007 at 08:11:33 (PST)

Уважаемый Илья!
Не смотря на то, что Вы носите иудейское имя Илиау Анави-пророка Ильи, Вы с обидой в голосе называете себя "гоем". А между тем слово "гой" в переводе с иврита- просто на просто: "народ". А поскольку моих братьев-евреев не считали народом, так и для евреев "гоями" определялись все, кто к нам не относился.
Родной брат моей бабушки - Григорий Абрамович Гольдберг был избран депутатом в последнюю Государственную Думу. Она продержалась каких-то пару месяцев.Всего два еврея от Кадетской партии. Так кто же Россию "профукал"? Простите, Ваши доводы не убедительны...
Мне не понятно: почему Вас, голубчик,потянуло разбираться в истории антисемитизма? Смею Вас уверить, что она не начиналась с Кремля и за его стенами не закончится! Последний приём в Кремле лидера Хамаса:такая любовная сцена между главным террористом и Лавровым! Для полной гармонии не хватало покойного Арафата.А"слабо" Лаврову было спросить: "Где израильский похищенный солдат Гильад Шалит?" А что Вы там о "пассионарности" Льва Троцкого? Палестины бы ему не хватило? Не бойтесь, длинная рука Сталина и здесь бы его достала! И зря Вы его с Наполеоном сравниваете! У нас был свой военный коммандир- Иосиф Трумпендор! Руку потерял на Русско-японской войне!И наши северные границы защищал до последней минуты... Вот это личность!Почему Ваши сегодняшние антисемиты любят пользоваться термином Льва Гумилёва "пассионарность"? Попробуйте развить эту тему поглубже.
Есть у меня несколько замечаний и о Вашем любимом еврее "великом Иесусе Христе". Откройте мне секрет: это чем он был так "велик"? Никакого рукописного наследия не оставил. Ведь учился же в серьёзной школе? Или был дислектиком? Доверился ученикам? Да и те не сразу записали о "его деяниях". И от родителей, считайте, попросту отрёкся!Стыдился, что отец Иосиф - столяр? Но мать Мирьям в чём виновата? Полтора десятка лет бродяжничать и не навестить родную маму? Вот это действительно не по-еврейски.
Я принадлежу к тому самому колену Леви, которое, по-Вашему определению, "вернулось на родину".Я со своей семьёй давно вернулась. Но смею Вас уверить, что и Коганы, и Левины до сих пор проживают не только в Москве, Питере и Лондоне...Не судите по остальным, если сестра Вашей жены соблазнила еврея. "Все десять колен растворились в других народах???" Всего одно или два колена пропало. Но их найдут. Не волнуйтесь! АМ ИСРАИЛЬ хай!!!
Ольга Левин.


Матроскин
- Wednesday, February 28, 2007 at 06:47:19 (PST)

FOXNEWS.COM HOME > WORLD

Four Killed in China Train Derailment
Wednesday, February 28, 2007
= = = = = =

В Китае в 2 часа утра местного времени песчаная буря сдула с рельсов пассажирский поезд из 11 вагонов. 4 человека погибли, не менее 30 ранено. Ураганный ветер пришел в Китай из Внутренней Монголии.



Буквоед - Ontario14
- Wednesday, February 28, 2007 at 05:58:11 (PST)

чудовище Dodge Caravan въехал в мой Civic, стоящий последним в будничной торонтовской "5pm" пробке. У меня ничего не сломано (удар креслом по голове и шее - не в счет), но exhaust оказался на земле... Так что у меня стресс ...
---
А что Ваша страховая компания говорит? Вне зависимости от этого к врачу сходите обязательно. Пока лечитесь спиртным по принципу Безенчука из "Двенадцати стульев": "Нам растираться не к чему". Будьте здоровы.



Ontario14
- Wednesday, February 28, 2007 at 05:00:09 (PST)

Уважаемые Старый еврей, М., Игрек,

"Был бы человек, а нарушенная заповедь всегда найдётся", - как говорят наши друзья из ХАБАДа.
Да, теилим и "биркат а-гомель" с цдакой.

Игрек - из алкогольных напитков априори кошерно всё, где в процессе производства не принимал участия виноград. Вино,коньяк, кальвадос, граппа и т.д. требуют специального сертификата кошерности.

Всем спасибо и всех благ!


Арабы предложили Израилю нееврейскую конституцию
- Wednesday, February 28, 2007 at 04:56:27 (PST)

Общественная организация Адала (Adalah), действующая в интересах израильских арабов, выступила с предложением о принятии новой конституции, в которой учитывались бы интересы этнических меньшинств, пишет Ha'aretz.
По мнению составителей документа, Израиль должен быть не "еврейским", а "мультикультурным и двуязычным" государством. Кроме того, государство, считают в "Адале", должно взять на себя ответственность за "исторически несправедливые действия в отношении палестинского народа и его целостности".

Кроме этого предлагается отменить действие закона "О праве на возвращение", который действует для всех людей, имеющих хотя бы одного деда или бабушку еврейского происхождения, а вместо этого ввести закон, позволяющий селиться в Израиле арабам, покинувшим страну после 1948 года, и их потомкам.

Руководители "Адалы" считают, что пора изменить положения законодательства, согласно которым супруги израильских арабов из числа их соплеменников из Газы и с Западного берега не могут получить израильское гражданство.

Авторы документа считают, что Израиль должен уйти со всех территорий, оккупированных в 1967 году? и позволить палестинцам создать собственное государство.

Кроме этого, в проекте основного закона предусмотрены и другие компенсации и преференции в отношении арабских жителей Израиля и их потомков.

Стоить отметить, что проект, предложенный "Адалой", в современных условиях не имеет ни малейшего права на осуществление, так как Израиль официально считается еврейским государством, основанным на принципах сионизма.

Большинство израильтян выступают категорически против изменения действующего законодательства.
http://lenta.ru/news/2007/02/28/constitution/


Матроскин - С.Е.
- Wednesday, February 28, 2007 at 04:41:57 (PST)

Старый еврей
- Wednesday, February 28, 2007 at 03:33:01 (PST)
Матроскину
у меня к Вам большая, убедительная и настоятельная просьба.
Очень Вас прошу не обзывайте пожалуйста господина Тартаковского бранными словами.
= = = = = = = =

Господин С.Е.,

если Вы потрудитесь проанализировать в хронологическом порядке последние сообщения Тартаковского и мои, Вы без труда выясните, что хамить первым начал он. И это далеко не первый подобный случай.

Во-вторых, "полезные идиоты" - это прямая цитата из бессмертного Вождя и Учителя В.И. Ленина. Уже в силу этого она не может носить оскорбительного характера. Это просто констатация факта.

Что касатся возраста, то ни Вы, ни ПИ о моей биографии понятия не имеете, потому не следует фантазировать. Может быть я старше вас обоих. Откуда Вы можете это знать? Кроме того, возраст не является личным достижением и основанием для автоматического уважения. Что же касается эрудиции Тартаковского, то это большое заблуждение. Он в большинстве случаев с огромным апломбом несет несусветную чушь, не сомневаясь в том, что его мнение неоспоримо. Вы посмотрите любое сообщение этого "эрудита". У него фразы типа "мне кажется", "по моему мнению" и подобные просто отсутствуют. Зато самореклама из него так и прет. Что же касается истинного интереса к его "творчеству", то посмотрите на форумах количество обращений к его заметкам - смех и грех.

Будьте здоровы!


Модератор
- Wednesday, February 28, 2007 at 04:40:22 (PST)

Старый еврей
- Wednesday, February 28, 2007 at 03:33:01 (PST)
Матроскину
у меня к Вам большая, убедительная и настоятельная просьба.
Очень Вас прошу не обзывайте пожалуйста господина Тартаковского бранными словами.


Присоединяюсь к просьбе. И господина Тартаковского прошу воздерживаться от кличек. Пожалуйста, не опускайте планку беседы до уровня коммунальной кухни.
Спасибо за понимание.



Модератор
- Wednesday, February 28, 2007 at 04:24:31 (PST)

И – просьба к моим доброжелателям. Например, к Витаху, - научить меня превращать в Гостевой адреса в прямые отсылки.

Уважаемый Леон, я тоже отношу себя к числу Ваших доброжелателей и поэтому сообщаю: сейчас в целях борьбы со спамом прямые отсылки в теле сообщения не разрешаются. Потери от этой меры не велики: скопировать адрес и поставить его в окошко любимого Вами браузера - невелик труд. Зато экономия на уборке мусора огромная. И никакой парольной защиты мы не применяем.

Спасибо за заботу о рубрике - идея хорошая, нужен исполнитель.
Удачи!




ГЛЯДЯ ИЗ МААЛОТА
- Wednesday, February 28, 2007 at 04:00:02 (PST)

Уважаемые господа! Выражаясь высоким штилем я завершил свою каденцию ведущего рубрики «Глядя из Израиля». О чем сообщил Редактору, предложив продлить жизнь этой рубрики, но с измененным немного названием - «Глядя из Иерусалима». Который, как известно, находится «НАД небом голубым». Совсем неплохо: чем хуже названия передачи незабвенного Анатолия Максимовича «Глядя из Лондона»? Но нужен житель Иерусалима или его ближайших окрестностей, готовый каждый месяц поставлять в «Заметки» живой материал, основанный на личных впечатлениях. Предупреждаю: необходимость регулярной и по возможности актуальной и качественной продукции требует изрядных нервных затрат.
Я надеюсь еще печататься в «Заметках», когда у меня будет получаться нечто. Добрые люди научили меня размещать шедевры в своем разделе у Мошкова
( http://world.lib.ru/editors/p/professor_l_k/ ). Последний шедевр «Политическая активность по-над Монфортом», посвященный, если кому интересно, движению «Еврейское руководство», см. по адресу http://world.lib.ru/p/professor_l_k/070228_koval_vecheria.shtml .
И – просьба к моим доброжелателям. Например, к Витаху, - научить меня превращать в Гостевой адреса в прямые отсылки. Это нужно только здесь, потому что в других местах, которые я посещаю, все делается автоматически. Лучше всего напишите на мой И-мейл, чтобы было элементарно, по шагам и без употребления слов, которых я не понимаю (вроде «браузера»). Виноват, но что поделаешь – стар уже. Всем здоровья. Л. Коваль



Старый еврей
- Wednesday, February 28, 2007 at 03:33:01 (PST)

Матроскину
у меня к Вам большая, убедительная и настоятельная просьба.
Очень Вас прошу не обзывайте пожалуйста господина Тартаковского бранными словами.
Можно соглашаться или не соглашаться с ним и его воззрениями, но следует учесть, что он старше меня, не говоря уж о Вас и других посетителях "Гостевой", он - автор большого числа оригинальных работ, он - высокообразованный человек, он, пока его не оскорбляют, очень терпелив и благонастроен.
Я САМ В ПЫЛУ ДИСПУТА НЕ ВСЕГДА КОРРЕКТЕН И ПРОШУ У ВСЕХ, ОБИЖЕННЫХ МНОЮ, ПРОЩЕНИЯ!
ВСЕМ ВАМ СЧАСТЬЯ, ЗДОРОВЬЯ И УДАЧИ!


Студенты МГУ задержаны за недовольство деканатом
- Wednesday, February 28, 2007 at 03:22:51 (PST)


В среду трое членов инициативной группы социологического факультета МГУ были задержаны за акцию протеста в стенах вуза. Как сообщает «Эхо Москвы» со ссылкой на одного из задержанных, группа студентов распространяла на факультете листовки с требованиями студентов к декану. Недовольство учащихся вызвало то, что «на факультет не пускают по студенческим билетам того же ВУЗа, не пускают, если забыл пропуск», на факультете нет доступной столовой, «цены как в ресторане».

После этой акции студенты были задержаны и доставлены в УВД МГУ, где составляется протокол о «распространении продукции незарегистрированного СМИ». По мнению студентов, их задержание инициировала администрация факультета
// Майк Габриелян



Онтарио, колитесь!
- Wednesday, February 28, 2007 at 02:25:02 (PST)

Старый еврей
- Wednesday, February 28, 2007 at 01:48:51 (PST)
Моему уважаемому единомышленнику Онтарио
Я желаю Вам быть здоровым и благополучным, но одновременно с этим позволю себе рассказать Вам следующее: много лет назад один старый мудрый раввин объяснил мне, что ежели с человеком происходят неприятности, -- то человек должен воспринять их как предупреждение: "ага, значит я что - то сделал не так, сказал не так или подумал не так...
= = = = = =

Онтарио, колитесь! Чего Вы такого натворили?

А вообще, железо - это дело наживное. Главное, что все живы и здоровы!

Удачи Вам!

М.


Матроскин
- Wednesday, February 28, 2007 at 02:14:50 (PST)

«Эрудит» Тартаковский,
Есть несколько исключительно простых вопросов:
1) Евреи в соответствии с Торой провели в Египте 430 лет. За это время произошло всего лишь около 28 000 извержений вулканов. Почему КОНКРЕТНО! извержение Тэры (а не «Тира») является «уникальным»?
2) С каких пор Эгейское море является «замкнутым бассейном»?
3) Почему именно извержение Санторини «запечатлелся в народной памяти»?
4) В каких бессмертных произведениях «эрудита» Тартаковского имеются КОНКРЕТНЫЕ ответы на эти вопросы?


Вопросы просто предельно элементарные, особенно для бесконечно эрудированного автора бессмертных произведений, которые я бездарно копирую. Эрудит нашел время на реплику:
Тартаковский
- Wednesday, February 28, 2007 at 01:38:47 (PST)

А я вот ничуть не разочаровался в Мартышкине. Какой удобный персонаж!


Но ни одного конкретного ответа на вопросы нет. А почему? Да потому, что наш «эрудит» со всей дури залетел в капкан, который сам же для себя и поставил: кроме русского ни одного языка не знает, а искать ответы на других языках, да еще и в абсолютно неизвестной области – полная безнадега. И написать ответы задним числом невозможно. Товарищ эрудит не в состоянии даже объяснить, почему Эгейское море – замкнутый бассейн.

Но это далеко не первая, и несомненно не последняя глупость Тартаковского.

Владимир Ильич Ульянов (Ленин) называл тартаковских «полезные идиоты». Этот экземпляр несомненно является эталоном ПИ. Каждый район большого города должен иметь своего сумашедшего. Гостевая – не исключение.



Матроскин - Игреку
- Wednesday, February 28, 2007 at 01:57:49 (PST)

Игрек
- Tuesday, February 27, 2007 at 19:05:22 (PST)
Посмею заметить, что мне, как мужчине второй половины средних лет, мадонны Филиппо Липпи нравятся больше. Это из современников Р. и М. А из других итальянских гениев - мадонна Джотто в Уфицци.

Филиппо Липпи был монахом, а Рафаэль – жуиром. Первый писал с теоретическх образов Писания, второй – со своих многочисленных красавиц-любовниц. У Липпи все мадонны печально-озабочены, а младенцы упитаны со старческим выражением лиц. У Санти мадонны излучают сексапильность и жизнерадостность, а младецы все же больше походят на детей. Сравните каноничность лиц Липпиевской Мадонны с младенцем и двумя ангелами и Мадонны Магнификат работы Сандро Ботичелли. Впечатление, что оба писали с одной натуры. Хотя Ботичелли, в принципе, очень жизнерадостный художник.

Джотто же абсолютный гений, но он патриарх по отношению к М. и Санти, и писал строго в канонической манере.
По крайней мере мне так кажется. :)



O математиках и математике
- Wednesday, February 28, 2007 at 01:51:15 (PST)

Два математика в ресторане поспорили, насколько хорошо знают математику большинство людей. Один (пессимист) утверждал, что большинство ее вообше не знает, а другой (оптимист) - что хоть и не много, но знают. Когда пессимист отошел в туалет, оптимист подозвал симпатичную официантку-блондинку и говорит:
- Когда мой коллега вернется, я задам вам вопрос. Суть не важна. Все, что вы должны сделать - это сказать "Треть икс куб".
- Как-как? Третий скуп? - переспрашивает официантка?
- Да нет, Треть Икс Куб, Понятно?
- А-а! Третик скуп? - повторяет официантка.
- Да, да. Это все о чем я вас прошу.
Официантка уходит твердя про себя как заклинание фразу "Третик скуп". Тут возвращается пессимист. Оптимист говорит - давай спросим у нашей официантки чему равен какой-нибудь простенький интеграл. Пессимист, со смехом соглашается. Оптимист вызывает официантку и спрашивает:
- Извините, вы не помните чему равен интеграл от x^2 по dх?
- Треть икс куб... - отвечает официантка.
Пессимист сильно удивлен, оптимист весело смеется. Официантка отходит на несколько шагов, и обернувшись через плечо добавляет:
- ...Плюс константа.
Немая сцена.


Старый еврей
- Wednesday, February 28, 2007 at 01:48:51 (PST)

Моему уважаемому единомышленнику Онтарио
Я желаю Вам быть здоровым и благополучным, но одновременно с этим позволю себе рассказать Вам следующее: много лет назад один старый мудрый раввин объяснил мне, что ежели с человеком происходят неприятности, но не роковые трагедии (к примеру, автопроисшествие без ранений), то человек должен воспринять их как предупреждение: "ага, значит я что - то сделал не так, сказал не так или подумал не так... Мне надо незамедлительно пересмотреть свое прошлое и раскаяться в найденных совершенных ранее грехах". Надо срочно совершить Тшуву в содеянном греховном. Ну, а уж, что читать надо Тегилим, я и не говорю - для Вас это азбука.
Прошу прощения за поучения, ибо знаю, что все это Вы знаете значительно больше и лучше меня...
Желаю здоровья, счастья и благополучия!!!!!!
Будьте здоровы и счастливы.


Тартаковский
- Wednesday, February 28, 2007 at 01:38:47 (PST)


Матроскин - Тененбауму
- Tuesday, February 27, 2007 at 16:31:42 (PST)

Б.Тененбаум - Матроскину
- Tuesday, February 27, 2007 at 15:43:44 (PST)
-------
Наверное, коты не слишком восприимчивы к искусству ?
= = = = = = =

Это, пожалуй, единственное, от чего я могу потерять пульс. Но я по натуре человек скептический, потому довольно быстро обнаруживаю всякие несуразности. В частности, сильно разочаровался в Микельанжело....

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<

А я вот ничуть не разочаровался в Мартышкине. Какой удобный персонаж!


М.Тартаковский,
- Wednesday, February 28, 2007 at 01:35:07 (PST)


Б.Тененбаум - М.Тартаковскому
- Tuesday, February 27, 2007 at 14:37:47 (PST)

-----
Уникальны и отношения фараона с женой Нефертити, которая, вероятнее всего, была иноземкой; согласно моему предположению – еврейкой...
------
МС, я очень мало знаю о гебраистике, да и о Египте - не слишком осведомлен. Но все-таки - почему вы решили, что Нефертити была именно еврейкой ? Если следовать канону, то в ту пору весь "израиль" состоял из одной семьи - патриарха Иакова и его сыновей. Если я не прав, пожалуйста, поправьте меня. Какова же вероятность того, что девушка из этой не выдающейся в династическом плане семьи попала в гарем фараона Египта, да еще на столь руководящую позицию ? :)

>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<<<<

Во-первых, взгляните на дату царствования Эхнатона.
Во-вторых, прочтите "Откровение Торы". /Более полный текст не в "Заметках" №№ 3 и 4, но по адресу: whoiswho - "Кадровая политика № 2/2003. Там и в "бумажном издании" и в виртуальном/.
Неужели же разумно пересказывать здесь всё сначала?
Ещё. Я помню Ваши вопросы по поводу Ливанской войны. Дел выше головы. Разберусь с ними - непременно отвечу.
Желаю бодрствовать.


Еврейский мир и метрополиЯ русского Языка
- Wednesday, February 28, 2007 at 01:31:57 (PST)

Русско-еврейские писатели продолжают писать на русском языке, так и не ставшем для них двоюродным. Количество книг, выходящих сегодня в Израиле на русском, выше, чем десять или двадцать лет тому назад. Русскоязычные израильские писатели – граждане еврейского мира – создали аж три объединения-союза, и отношения между этими организациями не вполне безоблачны. Вместе с тем конфликт, сшибка – пружина литературного прогресса, и это немного утешает…

Учреждение израильского отделения Международной федерации русскоязычных писателей привлекло внимание пишущих и читающих людей. Проведенная в Тверии на прошлой неделе при финансовой поддержке фонда Михаила Черного, эта встреча сорока литераторов стала не просто поводом для создания четвертой писательской организации. Она внушила надежду на то, что в непростых израильских условиях есть место для существования творческого Союза, поставившего своей целью поддержку и помощь тем немногим, кто считает литературу своей истинной профессией. Международная структура Федерации с центром в Будапеште сделает реальностью профессиональные контакты между русскоязычными писателями, живущими в десятках стран мира. Такое цеховое единство, наряду с иными возможностями литературной Федерации, послужит распространению культуры, публикации книг и их переводу с русского на иностранные языки.
http://www.e-slovo.ru/330/k2.htm


3 марта вечером начинается празднование Пурима
- Wednesday, February 28, 2007 at 01:28:10 (PST)

ЦАРЮ НУЖНЫ ТВОИ ДЕНЬГИ

Пурим – самый веселый еврейский праздник. Веселье не просто подобает Пуриму – это заповедь, органически связанная с другими праздничными заповедями. О двух из них я хотел бы сегодня поговорить. Это мишлоах манот – маленькие подарки родственникам и друзьям (что-нибудь вкусненькое) и помощь бедным. Подарки – символическое проявление нашей любви или уж во всяком случае доброжелательности, они поднимают настроение и тем, кто дарит, и тем, кто принимает подарки. Деньги для людей, оказавшихся в стесненном материальном положении, всегда кстати, особенно в праздник. Они дадут возможность купить что-нибудь к праздничному столу или порадовать себя какой-нибудь иной приятной покупкой. Настроение повышается, и человеку легче исполнить заповедь о веселье.



Однако этими очевидными соображениями смысл пуримских подарков и пуримской благотворительности все-таки не исчерпывается. О чем говорится в мегиле – свитке с текстом книги Эстер, который читают в этот день в синагоге? О смертельной опасности, нависшей над евреями Персидской империи, о неожиданном спасении, – ставшими символом всех опасностей и всех спасений на протяжении всей нашей истории. Анализ рассказанных в книге событий приводит к выводу, что внешняя угроза стала следствием ослабления национальной самоидентификации, ассимиляции, утраты взаимной ответственности и национального единства. Внутренняя опасность не была в достаточной степени осознана – и тогда явилась опасность внешняя.

Без мудрости Мордехая и самоотверженности Эстер еврейский народ не был бы спасен, но, и это особо подчеркивается, спасения не было бы без национального покаяния и восстановления национального единства.

В книге Эстер говорится о еврейском народе. Однако здесь есть важный универсальный смысл. Народ (любой народ) не может существовать как собрание индивидуалистов, равнодушных к общим ценностям, не испытывающих чувства солидарности, помышляющих только о собственной выгоде, готовых брать, но не готовых давать. С другой стороны, человек, отгораживающийся от других людей, обрекает себя на неполноту жизни, потому что полнота жизни возможна только в преодолении своей обособленности, в единстве с другими людьми.

Единство невозможно без любви, а любовь деятельна, любовь всегда готова к самоотдаче.

Готовность отдавать связывает человека с другими людьми. Ее отсутствие разрушает социальные связи. Мишлоат манот и помощь бедным, помимо своего непосредственного практического смысла, еще и символическое выражение нашей готовности давать.

Есть такая старая байка. Два еврея обсуждают вопрос о помощи бедным. Один говорит:

– Я вообще не понимаю, почему Всевышний требует от меня, чтобы я помогал бедным. Ведь Он всемогущий? А раз всемогущий, вполне мог бы сделать так, чтобы бедных не было. Тогда бы и благотворительность не потребовалась.

Его собеседник вместо прямого ответа вспоминает другую байку, которая вложена в первую, как матрешка. Это тоже разговор, но уже других собеседников.

Некто спрашивает:

– Зачем царю налоги?

Другой отвечает:

– Как зачем? Чтобы страна могла существовать. Чтобы было чем платить учителям, врачам, ученым, полицейским, чтобы было на что содержать армию, правительство.

– Да ведь печатный станок принадлежит царю.

– Ну так что?

– А то, что и напечатал бы денег, сколько ему надо, без всяких налогов.

– Чудак, царю не нужны свои деньги – царю нужны твои деньги.

Царю Небесному нужны «деньги» нашего доброго сердца, нашей солидарности. Всевышний хочет, чтобы мы потрудились, и в процессе исполнения заповедей изменились бы сами и изменили мир, сделали его более человечным. На самом деле дающий получает ничуть не меньше, а обыкновенно больше, чем тот, кому адресован его дар.

Б-г действительно может все. Он может не только сделать так, чтобы бедных не было, но и чтобы в мире тотчас воцарилось царство абсолютного добра. Мы знаем, почему Он этого не делает: создав человека, Всевышний дал ему возможность сделать это самому. Мы можем совместными усилиями превратить этот мир в полный кошмар, в место совершенно невозможное для существования. А можем превратить в место взаимной любви и солидарности. К чему и призывает нас праздник Пурим.

Главный раввин России

Берл Лазар




«Уже никто не заикался о том, чтобы лидеров ХАМАС принял президент Путин»
- Wednesday, February 28, 2007 at 00:31:46 (PST)

А вот риторика России, мне кажется, стала более острожной, по крайней мере, сейчас уже никто не заикается о том, чтобы лидеров движения ХАМАС принял президент Владимир Путин. А ведь в прошлый раз такие слухи ходили. По моим сведениям, они были более чем обоснованные. Такой вариант обсуждался и в Кремле, и в мире. Но в последний момент было понято, что движение ХАМАС не собирается пока менять своих политических позиций, и такая встреча может навредить имиджу России.
http://www.svobodanews.ru/Article/2007/02/28/20070228100415803.html


"Теорема несокрытия" и информационный парадокс черных дыр
- Tuesday, February 27, 2007 at 23:58:37 (PST)

На вопрос о том, хранит или не хранит черная дыра поглощенную информацию, теоретики до сих пор дают самые причудливые ответы. Так, например, содержащаяся внутри коллапсара информация может не исчезать, а переноситься в какую-то другую вселенную, одну из множества "пузырьков" в общей "пене" пространства-времени, туннелем в который и является та или иная черная дыра (заканчивающаяся на другом своем конце "белой дырой"). Еще одна гипотеза состоит в том, что черные дыры никогда не испаряются полностью, а съеживаются до размеров микрочастиц и в таком виде сохраняют всю содержащуюся в них информацию до конца существования нашей Вселенной. Для подобных "информационных частиц" даже придумали подходящие названия - "информоны", "инфотоны", "библиотеконы". Одна из относительно свежих идей заключалась в том, что эти самые информоны могут обладать лишь очень малой частью начальной информации (основная ее доля "распылена" где-то в окружающем пространстве), но при этом несут с собой тот самый "ключ", без которого эта информация никак не может быть расшифрована (даже частично) и возвращена в мир. Если Бронштейн и Пати правы, то подобные гипотезы можно уже назвать несостоятельными...

В 2000 году вышеозначенный информационный парадокс под номером восемь был назван в числе десяти важнейших проблем физики, которые должны быть решены в течение следующего тысячелетия. Этот список включал проблемы вроде определения продолжительности жизни протона (собственно, прежде всего стоит вопрос о его стабильности или нестабильности), а также исчерпывающее объяснение происхождения Вселенной. Впрочем, полноценное решение информационного парадокса черных дыр возможно лишь после создания корректной теории квантовой гравитации, объединяющей релятивистскую теорию (общую теорию относительности или какой-то ее аналог) с квантовой механикой.

http://grani.ru/Society/Science/m.118666.html


ЮЛИЯ ЛАТЫНИНА: Клеветники России
- Tuesday, February 27, 2007 at 23:49:30 (PST)

В декабре прошлого года, в разгар дела Литвиненко, по всем телеканалам прошел страшный сюжет о том, как в деревне Прямухино Тверской области негодяи-алкоголики, которым местный священник Андрей Николаев мешал спиваться, спалили его в собственной избе с женой — матушкой Ксенией, и детьми.

В репортажах заявляли, что дверь избушки была подперта, что на окнах ее были решетки, что священник получал угрозы, что у отца Андрея уже сгорели дом и баня.
Между тем и церковь, и следствие не спешили с шумными комментариями. Вскоре выяснились не менее жуткие, но существенно иные подробности. Никто ничем дверь не подпирал. Зато накануне о. Андрей сам купил канистру бензина. Дом небольшой, решеток на окнах нет, выбить и выпрыгнуть – пара пустяков. Пепел матушки Ксении и детей лежит в одной комнате, о. Андрея – в другой. Почему не выпрыгнули, если были живы – непонятно. Дом о. Андрея действительно горел до этого (один раз дом, другой – баня), но при этом строения были застрахованы, что для сельской местности почти невероятно. О.Андрей был крайне нелюдим последнее время, странен характером, с матушкой Ксенией были большие раздоры…
Словом, похоже – трагедия. Страшная, чудовищная трагедия, но трагедия, коренящаяся в душе одного отчаявшегося человека — и не случайно церковь неохотно и крайне скупо комментирует эту историю.

Но вопрос вот какой. Представьте себе либерального журналиста, который, не имея к тому ни малейших оснований, нещадно перевирая факты, рассказывает, что русский народ озверел так, что сжег с женой и детьми священника, который мешал ему пить. Что бы сказали этому журналисту? Ублюдок! Христопродавец – хоть одно доказательство приведи! Так как же назвать тех руководителей госканалов, которые на протяжении трех дней, не получая подтверждений от следствия, от властей губернии, потчевали нас рассказом о русском народе – звере и быдле, чтобы перешибить запах полония?
http://ej.ru/dayTheme/entry/6260/


Игрек
- Tuesday, February 27, 2007 at 20:57:30 (PST)

Онтарио14

Конечно же я Вам сочувствую, но моя покойная бабушка учила видеть во всем хорошую сторону. Во-первых, это была малютка Додж Караван, а не какой-нибудь монстер Форд Экспедишен. Во-вторых, Вас ударили сзади, так что хоть Вашей вины нет (впрочем, в Миннесоте это было бы все равно частично Ваша вина - еще один плюс в Вашу сторону), в третьих, появился 100% надежный повод выпить и слегка расслабиться. В четвертых, Вы еще успеете обыграть случившееся в Пуримшпигеле - и все будут смеяться.
Но вопрос, который задел меня за живое - А что, виски - напиток кошерный?? Я в этом, оказывается, полный чурбан. Не в виски, а в кошерности. Виски я люблю. Сингл молт, начиная с 12 летнего. Причем в силу отсутствия утонченного вкуса, не отличаю ирландский от шотландского, чем раздражаю моего товарища, большого любителя этого типа самогона. Впрочем, не мне Вам объяснять, с виски те же проблемы - хорошие начинаются с 30 долларов.

П. С.
Все же завтра обязательно зайдите к врачу. Удар креслом по голове, как и удар головой по креслу, дает себя знать не сразу.

П.С.С.

В прошлом году я с дочерью ночью в снегопад и глубоко в горах ехал миль 20 МЕЖДУ двумя Хаммерами H-3. Они гнали со скоростью миль в 60. Чуть не обписался от страха.


Ontario14
- Tuesday, February 27, 2007 at 20:54:37 (PST)

Про Испанию:

Название реки Гвадалькивир происходит не от арабского "аль-уад аль-кабир"(Большая река). Всё намного сложнее и веселее ... :-))) Выясняется, что сей гидроним происходит( кто подумал "от еврейского" - ошибся) от арабского же "аль-гауад аль-кабир"(согласитесь - более похоже !), что означает "Главный Сутенер". Интересно - почему ?




Ontario14
- Tuesday, February 27, 2007 at 19:39:01 (PST)

Исаак
- Tuesday, February 27, 2007 at 08:49:24 (PST)

*****

Уважаемый Исаак, честно говоря - нить утеряна(мною!). В чём там спор, если можно выразить в одном предложении ? В любом случае, скорого ответа не будет. Сегодня вечером я первый раз в жизни оказался замешанным в ДТП: чудовище Dodge Caravan въехал в мой Civic, стоящий последним в будничной торонтовской "5pm" пробке. У меня ничего не сломано (удар креслом по голове и шее - не в счет), но exhaust оказался на земле... Так что у меня стресс ... А там и Пурим не за горами, со всеми вытекающими оттуда последствиями. Лечусь. Игрек, а Вы только против бурбона что-то имеете, или против виски вообще ?


Ontario14
- Tuesday, February 27, 2007 at 19:24:09 (PST)

Adam
- Tuesday, February 27, 2007 at 13:08:14 (PST)

**********

Буш-отец, закрывший Америку в 1989 году - просто антисемитская сволочь. Бедному Израилю нужен был весь этот зевель ?!


Игрек
- Tuesday, February 27, 2007 at 19:05:22 (PST)

Матроскину

"Но в этом смысле Рафаэлевские мадонны, разумеется, вне всякой конкуренции. Кстати, Рафаэль Санти и М-о друг друга совершенно не переваривали"

"""""

Посмею заметить, что мне, как мужчине второй половины средних лет, мадонны Филиппо Липпи нравятся больше. Это из современников Р. и М. А из других итальянских гениев - мадонна Джотто в Уфицци. По поводу любви-нелюбви. Абсолютно нормальные взаимоотношения двух художников, борящихся за ограниченные денежные гранты заказчиков. Примерно в таких же взаимоотношениях находятся большинство профессоров-на грантах в американских университетах. Если мне не изменяет память, то во Флоренции однажды был конкурс между Р. и М. на втором (кажется) этаже Синьории, в зале заседаний, когда им одновременно дали заказ на роспись противоположных стен. Какая любовь в таких условиях. Не били друг другу морды, слава Б-гу.
Откуда взялось так много в 13-16 веках? Я думаю (не очень оригинально), что виноваты культурные традиции, относительная свобода духа и самовыражения, жесткая конкуренция как среди самих гениев, так и среди заказчиков, богатая жизнь, требующая эстетики, ум и вкус заказчиков, появление довольно многочисленных меценатов, мощный подъем национального духа (даже если под этим понимать город Сиена), наконец, появление новых капиталистических предпосылок разделения труда, усовершенствования техники (над этим они работали десятилетиями)и так далее. Немаловажно было и то, что с самого начала были заложены образцы невероятно высокого качества - Данте и Джотто - к которым надо было стремиться. Не последнюю роль сыграло и народное образование. Университеты Болоньи и Сиены были из лучших в Европе. Плюс к этому времени вино сильно подешевело, а без этого настоящему художнику никак.


Victor-Avrom, рав
- Tuesday, February 27, 2007 at 18:21:12 (PST)

12 Как упал ты с неба, светоносный, сын зари! разбился о землю, попиравший народы.
13 А говорил в сердце своем: "взойду на небо, выше звезд Божиих вознесу престол мой и сяду на горе в сонме богов, на краю севера;
14 взойду на высоты облачные, буду подобен Всевышнему". (Ис 14:12-14)

Кстати, только сейчас догадался что это за "край севера". ОООчень трудно догадаться. Ну, кто смелый?


Матроскин - Игреку
- Tuesday, February 27, 2007 at 17:58:10 (PST)

Насчет "грудной топографии" - это сказание, поскольку он при всей нестандартности (или наоборот - стандартной ориентации для гениев) все же пользовался как натурщиками, так и натурщицами. Но в этом смысле Рафаэлевские мадонны, разумеется, вне всякой конкуренции. Кстати, Рафаэль Санти и М-о друг друга совершенно не переваривали.

Но Вы скажите другое: откуда в Италии материализовалось такое количество совершенно гениальных художников, скульпторов, архитекторов и пр пр. пр.?


Матроскин
- Tuesday, February 27, 2007 at 17:43:23 (PST)

Victor-Avrom
- Tuesday, February 27, 2007 at 17:23:03 (PST)
= = = = = =

Я не сканирую пленку ввиду полного отсутствия нужды в этом. Я работаю с кодаковской 36 мм пленкой Elite Color Professional, c которой можно делать отпечатки 60х90 см без видимого зерна. Бумага Фуджи Кристалл Архив с изумительной цветопередачей и гарантией сохранения цвета 150 лет. Это превышает мои потребности в 10 раз. Чтобы сделать такой же отпечаток с цифры нужен семицветный лазерный принтер стоимостью 15000 евро, который есть не в каждом крупном европейском городе.


Матроскин - Игреку
- Tuesday, February 27, 2007 at 17:32:55 (PST)

Уважаемый Игрек,

бедняга Микельанжело должен был тянуть две упряжки, поскольку алчная семейка отбирала у него почти все. Тем более непонятно, зачем он рубил сам, когда практически все скульпторы делали модели, а рубили "негры". У него же все время уходило именно на рубку и окончательную отделку с колоссальным браком. Ну, мужеподобные дамы с рельефными бицепсами и трицепсами - дань моде на мужские тела, считавшиеся тогда эталоном красоты. Однако, нельзя же все время списывать простые геометрические просчеты только на недостаточное количество хороших камней.

А вот фрески Сикстинского плафона возражений действительно не вызывают, если не считать риска окончательно свернуть себе шею.:)



Victor-Avrom
- Tuesday, February 27, 2007 at 17:23:03 (PST)

Матроскин

Нет, потому что я приверженец пленки.


So? You do not have scanner?


Игрек
- Tuesday, February 27, 2007 at 17:22:38 (PST)

Матроскину

Кстати, есть стандартное объяснение "нестандартного" расположения груди (грудей?) в его женских нагих скульптурах. Злые языки утверждают, что он никогда не видел правильного их расположения в натуре. Бывает. Слава богу, в Италии было достаточно знатоков этого дела. Канова - лучший из них.
Что касается мужских фигур, то многие женщины твердо убеждены, что у Давида в Академии (не на пьяцца Сеньориа) абсолютно все в порядке. Евреи, правда, сильно озабочены необрезанностью еврейского мальчика. Но котам, наверно, все равно.


Матроскин
- Tuesday, February 27, 2007 at 17:16:24 (PST)

Victor-Avrom
- Tuesday, February 27, 2007 at 17:05:03 (PST)

Выложили в интернете?
= = = = = = =

Нет, потому что я приверженец пленки. Несколько лучших снимков фотосессии печатаю в большом формате и в рамочку.



Игрек
- Tuesday, February 27, 2007 at 17:08:06 (PST)

Уважаемый Кот,
видете ли, Микеланджело мог себе позволить многое, что нам, простым двуногим, совершенно непозволительно. Ну, например, он мог сделать Марию моложе Христа в знаменитой Пьете в Римском соборе св. Петра. Думаете он не понимал, что мама 33-х летнего сына не может выглядеть шестнадцатилетней? Или, может быть, Вы думаете, что заказчики это несоответствие не заметили?
С флорентийскими работами М. вообще-то была закавыка. Была причина, по которой и флорентийская Пиета и знаменитая Ночь в Каппеле Медичей оказались странными. Дело в том, что этот самый М. долгое время работал скульптором во Флоренции как бы по совместительству. Основная работа его была главным инженером фортификационных сооружений для защиты Флоренции. Даже отрываясь от основной работы на мелочишку - сдалать какую-нибудь Пиету или Утро-День-Вечер-Ночь - он непрерывно думал об основной работе. И параллельно чертил, изобретал, считал, строил все нужное для получения денег на основной работе. Тут не до соблюдения размера рук у Никодима.
Но хоть с его фресками в Риме Вы согласны?


Victor-Avrom
- Tuesday, February 27, 2007 at 17:05:03 (PST)

Матроскин
Сделал много снимков новой камерой с хорошим набором объективов, что особенно важно в таких старых городах.


Выложили в интернете?


Матроскин - Тененбауму
- Tuesday, February 27, 2007 at 16:31:42 (PST)

Б.Тененбаум - Матроскину
- Tuesday, February 27, 2007 at 15:43:44 (PST)
-------
Наверное, коты не слишком восприимчивы к искусству ?
= = = = = = =

Это, пожалуй, единственное, от чего я могу потерять пульс. Но я по натуре человек скептический, потому довольно быстро обнаруживаю всякие несуразности. В частности, сильно разочаровался в Микельанжело. Как Вы знаете, он никогда не делал моделей, а рубил сплеча. В результате у него почти все или испорчено, или не закончено. Особенно меня поразила его Пьета с Никодимом. Он же даже хотел эту группу разбить, но ученик упросил его отдать ее ему. Когда я обошел скульптуру сзади, я понял в чем дело. Микельанжело ошибся в длине рук Никодима, поддерживающих тело Христа. Причем, они короче рук Христа примерно в два раза. Так он себе надгробие и не сделал.


Б.Тененбаум - Матроскину
- Tuesday, February 27, 2007 at 15:43:44 (PST)

-------
общее впечатление от умирающего города битком набитого уникальными художественными ценностями было тоскливое - трудно себе представить, как это все можно спасти.
-------
Наверное, коты не слишком восприимчивы к искусству ? :) Вот и стихи Вам не нравятся, и Томаса Манна Вы не одобряете :)


Матроскин - Тененбауму
- Tuesday, February 27, 2007 at 15:29:37 (PST)

Б.Тененбаум - Игреку, Е.Берковичу. К вопросу о Венеции :)
- Tuesday, February 27, 2007 at 14:22:58 (PST)
= = = = = =

Мы с женой были в Венеции один раз около недели несколько лет назад. Устроились весьма недурно в заранее заказанных апартаментах в палаццо на Большом канале. Осмотрели очень прилично с изумительным экскурсоводом по 4 часа в день, а потом сами до упаду. Сделал много снимков новой камерой с хорошим набором объективов, что особенно важно в таких старых городах.

Но общее впечатление от умирающего города битком набитого уникальными художественными ценностями было тоскливое - трудно себе представить, как это все можно спасти.



Власти Израиля могут открыть доступ туристам к "могиле Христа"
- Tuesday, February 27, 2007 at 14:49:43 (PST)

По данным газеты The Jerusalem Post, израильские власти готовы открыть доступ для широкой публики к могиле в Восточном Тальпиоте (Иерусалим), в которой, как утверждает канадский режиссер Симха Якубович, около 2.000 лет назад были захоронены Иисус сын Иосифа (Иисус Христос), Иуда сын Иисуса, Мария, Мириам, Иосеф и Матвей. Израильское Управление древностей, в ведении которого в течение последних 27 лет находись раскопки этой могилы, отмечает, что окончательное решение по поводу доступа туристов к древнему захоронению должен принять муниципалитет Иерусалима....




Б.Тененбаум - М.Тартаковскому
- Tuesday, February 27, 2007 at 14:37:47 (PST)

-----
Уникальны и отношения фараона с женой Нефертити, которая, вероятнее всего, была иноземкой; согласно моему предположению – еврейкой...
------
МС, я очень мало знаю о гебраистике, да и о Египте - не слишком осведомлен. Но все-таки - почему вы решили, что Нефертити была именно еврейкой ? Если следовать канону, то в ту пору весь "израиль" состоял из одной семьи - патриарха Иакова и его сыновей. Если я не прав, пожалуйста, поправьте меня. Какова же вероятность того, что девушка из этой не выдающейся в династическом плане семьи попала в гарем фараона Египта, да еще на столь руководящую позицию ? :)


Б.Тененбаум - Игреку, Е.Берковичу. К вопросу о Венеции :)
- Tuesday, February 27, 2007 at 14:22:58 (PST)

В первый раз мы попали в Венецию в феврале 1981, ожидая в Италии визу на вьезд в США. Поехали туда поездом, естественно - денег было в обрез. Вышли из поезда, и попали под мелкий холодный дождь, пришлось срочно купить какие-то пластиковые накрывалки, после чего началась дискуссия - купить ли нам кусочек пиццы или выпить чашку кофе - на оба этих мероприятия могло не хватить фондов :) Пошли по узеньким улочкам вглубь города - вода в каналах была зеленой и пахла так, что было впору надевать противогаз. Окна в домах довольно часто были забиты фанерой. "Венеция - прекрасный труп" - вспомнила цитату из записок Боткина наша образованная приятельница :) И тут случилось два события подряд - мы неожиданно вышли на площадь у Дворца Дожей, и из туч выглянуло солнце - море, простор, слегка восточный дворец, сильно похожий на картинку из сказки ! Впечатление было оглушительным - и незабываемым по сей день.


Из Москвы
- Tuesday, February 27, 2007 at 14:21:47 (PST)

В Москве с двухдневным визитом побывала делегация палестинского радикального движения ХАМАС, которую возглавлял руководитель его палитбюро Халед Машаль. Он встретился с российским министром иностранных дел Сергеем Лавровым, обсудив с ним, как отмечалось в официальных сообщениях, "вопросы ближневосточного урегулирования". Судя по итогам переговоров, хамасовцы смогли заручиться поддержкой России. Однако сам факт того, что палестинских радикалов в Москву не звали, может свидетельствовать о готовности самого ХАМАСа идти на уступки в противостоянии с Израилем


Евгений Беркович
- Tuesday, February 27, 2007 at 13:47:17 (PST)

Только в Венеции и Флоренции - больше нигде - можно заходить в ЛЮБУЮ церковь и с 99% вероятностью увидеть шедевры. Только в Венеции - и больше нигде - за каждым поворотом тебя с 99% вероятностью ожидает чудо.

Абсолютно точно. Только для того, чтобы его увидеть, надо там жить. Пусть несколько дней, но быть венецианцем, флорентийцем, а не туристом в группе. Вставать рано утром и никуда не спешить. И бродить вечером и ночью, и тоже никуда не спешить. И лучше всего жить не в гостинице, а в обычной квартире в центре Старого города.
Венецию и Флоренцию мы познавали именно так.
Удачи!



Zandy Iiona
Qgmqaihivv, Upoqsmzt Enklw - Tuesday, February 27, 2007 at 13:36:17 (PST)

Alliluja, or smth like that


Недоумевающий
- Tuesday, February 27, 2007 at 13:33:05 (PST)

Adam
- Tuesday, February 27, 2007 at 13:08:14 (PST)

Ну что ж Вы так не аккуратно... Только что редактор авторитетно разьяснил, что здешних завсегдатаев ничего, кроме еврейской культуры и истории не интересует, а Вы с какими-то русскими лезете... Игру портите...


Г. Нейгауз - Недоумевающему
- Tuesday, February 27, 2007 at 13:32:32 (PST)

Нет, не в курсе. Дураков и дур много. Среди любой конфессии и деноминации. На каждого(и каждую) внимания обращать - времени не хватает. Следуя известной гойской поговорке, лоб советую разбивать Вам. Дискуссия с Вами и Вам подобными закончена. Караул устал.


Буквоед - Недоумевающему и Матроскину
- Tuesday, February 27, 2007 at 13:25:04 (PST)

Вы антисемит?

Если Вы - еврей, тогда да.
---
Врёт он всё: коты антисемитами не бывают, они по другой части "анти"



Матроскин
- Tuesday, February 27, 2007 at 13:11:58 (PST)

Недоумевающий - Матроскину
- Tuesday, February 27, 2007 at 12:35:51 (PST)

Дорогой Матроскин! Вы кажется, проспались, потом опохмелились (или наоборот).

ЕБДН (еще более дорогой Недоумевающий),

даже ребенок знает, что опохмеляются не в процессе выпивки, а после нее. Потому Вам грозит переименование в соответствии с Вашей безграмотностью.

Я изучил Ваш постинг вдоль, потом поперек, потом по диагонали. Но ничего, хоть отдаленно напоминающего еврейскую историю и культуру не нашел.

Плохо изучали, попробуйте еще. Если со зрением неважно, попытайтесь сделать глаза, как у китайца, и прочесть с торца экрана сверху вниз.

Вы антисемит?

Если Вы - еврей, тогда да.



Adam
- Tuesday, February 27, 2007 at 13:08:14 (PST)

Разновидности русских (из газеты hа-Aрец):


Переводить не буду, хто не понимает тот ...
:)


Буквоед
- Tuesday, February 27, 2007 at 13:08:07 (PST)

А.Кураев заявил, что за фильмом Камерона стоят масоны. Воздержался от
слова "жидо-масоны", хотя продюсер Камерона - Симха Якубович
(Jacobovici).
---
Так я на эту "сионистскую провокацию" еще до Кураева указывал здесь на сайте. Нет пророка в своем отечестве



От Кротова
- Tuesday, February 27, 2007 at 12:56:14 (PST)

Джеймс Камерон снял фильм, в котором утверждается, что ещё в 1980-м
году в Тальпиоте (ныне пригород Иерусалима) нашли гробницу с десятью
оссуариями, на которых были надписаны имена "Иисус сын Иосифа",
"Мария", "Иуда сын Иисуса". Треть века учёные якобы расшифровывали
надписи, анализировали ДНК и пришли к выводу, что нашли останки
Иисуса, его жены Марии Магдалины и их сына Иуды.

Профессор археологии Амос Клонер, который и проводил раскопки, назвал
претензии Камерона забавными. Он подчеркнул, что имена - очень
обычные, что семья Иисуса не могла иметь такую роскошную гробницу.
"Расшифровывать" тоже ничего не требовалось.

Не только атеисты горазды искать материальные подтверждения своего
неверия. В 2002 г. профессор Сорбонны католик Андре Лемэр объявил о
находке оссуария, на котором была надпись "Иаков сын Иосифа брат
Иисуса". Оссуарий оказался подлинным, а надпись - фальшивкой.

А.Кураев заявил, что за фильмом Камерона стоят масоны. Воздержался от
слова "жидо-масоны", хотя продюсер Камерона - Симха Якубович
(Jacobovici).


Игрек
- Tuesday, February 27, 2007 at 12:48:25 (PST)

Недоумевающему

В палитре художника и просто нормального человека должны быть различные краски. Хотя бы семь основных, но чем больше, тем лучше. Вы же пока пользуетесь очень ограниченным их количеством. Как в свое время газета "Правда". Евангелия - только часть проблемы. Антисемитизм был до них, есть вне их, будет и после них. Многие христиане не находят в Е. антисемитизма и соответственно ведут себя как христиане-не антисимиты. Многие находят антисемитизм в Е., но ведут себя как не антисемиты. Большинсто же христиан вообще об этом не задумывается и ведут себя согласно своей общинной культуры, семейных традиций, указаний своего пастора, попа, ксендза и так далее. Отношение же евреев к христианам тоже никак одной краской не рисуется, во всяком случае тех евреев, которые способны сами думать, а не идти в струе последних указаний партии.
Если Есаул выйдет из изгнания, возглавит ЦХАЛ и разгромит всех врагов, то большинство будет его очень уважать и не вспоминать его религию, кто-то бурчать примерно как Вы сказали, кто-то сильно его не любить именно за то, что еврем нос утер. Это все нормально. Я за то, чтобы он попробовал, а там посмотрим.


Недоумевающий - Матроскину
- Tuesday, February 27, 2007 at 12:35:51 (PST)

Матроскин
- Tuesday, February 27, 2007 at 11:49:25 (PST)

Дорогой Матроскин! Вы кажется, проспались, потом опохмелились (или наоборот).
Я изучил Ваш постинг вдоль, потом поперек, потом по диагонали. Но ничего, хоть отдаленно напоминающего еврейскую историю и культуру не нашел.
Вы антисемит?


Игрек
- Tuesday, February 27, 2007 at 12:28:35 (PST)

Евгению Берковичу

Прочел по Вашей ссылке Ваши венецианские воспоминания. Хотя я был в Венеции тринадцать раз, но все "пробегом", каждый раз с 10 утра до 6 вечера. С удовольствием частично обменял бы это время на вечернюю и - особенно - утреннюю Венецию, когда на Сан-Марко только голуби и полтора человека случайных прохожих. Венеция, безусловно, сказка, но сказка сюрреалистичная. Как будто бы все видишь через толстое цветное стекло, без фокуса, без резкости. К деталям неустроенного быта, запахам, запустению окраин, избытку туристов лучше не присматриваться и не прислушиваться - и именно в Венеции это возможно. Тогда все будет просто замечательно.
Только в Венеции и Флоренции - больше нигде - можно заходить в ЛЮБУЮ церковь и с 99% вероятностью увидеть шедевры. Только в Венеции - и больше нигде - за каждым поворотом тебя с 99% вероятностью ожидает чудо. Только в Венеции ты можешь бесплатно зайти в собор Санта Мария деи Фрари и увидеть Тациановское "Вознесение девы Марии", а если ты еще знаешь с какой стороны, в какое время и при каком освещении подойти, то можешь ДЕЙСТВИТЕЛЬНО увидеть Вознесение.
Вообщем, спасибо Е. М., за навеянные воспоминания.


Gena
- Tuesday, February 27, 2007 at 12:26:16 (PST)

AK
Boston, MA - Tuesday, February 27, 2007 at 12:15:42 (PST)


Wow!!! Интересно!!!

Приятно знать, что я предвидел открытие, которое уже было сделано :-)

Значит, я всё-таки, начал в этой области что-то понимать :-)


Матроскин - Тартаковскому
- Tuesday, February 27, 2007 at 12:24:49 (PST)

М. ТАРТАКОВСКИЙ.
- Tuesday, February 27, 2007 at 11:02:37 (PST)

И в «Заметках», и здесь, в гостевой, я не раз обосновывал /пытался обосновать/ своё предположение, касающееся Исхода. Разумеется, вулканический взрыв острова Тира не был и никак не мог быть непосредственной причиной этого события.
Просто, уникальное явление в замкнутом бассейне запечатлелся в народной памяти – и, полагаю, отражён в тексте Торы, - о чём я писал с понятной осторожностью.

Наш т.с. эрудит, напрочь лишённый творческих способностей /расходующий своё безразмерное безделье на копание во всяких случайных источниках/, время от времени перевирает написанное мной. И не только мной.

= = = = = = = = =

«Эрудит» Тартаковский.
Есть несколько исключительно простых вопросов:
1) Евреи в соответствии с Торой провели в Египте 430 лет. За это время произошло всего лишь около 28 000 извержений вулканов. Почему КОНКРЕТНО! извержение Тэры (а не «Тира») является «уникальным»?
2) С каких пор Эгейское море является «замкнутым бассейном»?
3) Почему именно извержение Тэры «запечатлелся в народной памяти»?
4) В каких бессмертных произведениях «эрудита» Тартаковского имеются КОНКРЕТНЫЕ ответы на эти вопросы?



Недоумевающий - Нейгаузу
- Tuesday, February 27, 2007 at 12:24:39 (PST)

Г. Нейгауз - Недоумевающему
- Monday, February 26, 2007 at 13:37:01 (PST)

Да ради Бога, Ольмерт-шмольмерт, лишь бы был здоров. Чего и Вам желаю.
Но Вы в курсе ли, господин пастор, что антисемитизм исчезнет только тогда, когда люди перестанут читать Евангелия? Другими словами, пока не исчезнут христиане? Это не мои мысли, это периодически высказывают то там, то сям в порыве искренности честные граждане еврейской национальности(за что им большое спасибо!).
Ну вот Вы, например. Допустим, Вы станете генералом, или даже маршалом Израиля. Изничтожите силу-силенную врагов Израиля. Нацепят Вам на грудь кучу орденов.
И что? Шепоток-то "этот гой нам хорошие услуги оказал, но христианин он и есть христианин, то есть антисемит" никуда не денется, не правда ли? Хоть Вы лоб разобьете в благодарственных молебнах, христианин-сионист?



AK
Boston, MA - Tuesday, February 27, 2007 at 12:15:42 (PST)

>Gena, Tuesday, February 27, 2007 at 10:35:01 (PST)
>>AK, Boston, MA - Tuesday, February 27, 2007 at 08:30:15 (PST)
>Значит, такая мутация возможна? Какое же численное значение приписывается получившемуся аллелю? 14? 15? 14.5?
######################

Уважаемый Gena,
Вы будете смеяться, но прямо передо мной лежит статья "Mutation rates at Y chromosome specific microsatellites", и в таблице записана экспериментально обнаруженная мутация этого самого маркера как 14--> 14.2





Матроскин
- Tuesday, February 27, 2007 at 11:49:25 (PST)

"Новости недели" №663 14.01.07

МАГАЗИН "НОСТАЛЬГИЯ"
Поучительная история о "чавычовой" красной икре
АЛЕКСАНДР РЫБАЛКА

Когда сюда приехала основная масса русскоязычных репатриантов... как грибы после дождя, появляться "русские" магазины. Справедливости ради необходимо подчеркнуть, что среди этих магазинов есть и такие, которые отличаются от капиталистических торговых точек только набором продуктов. Но в основном там можно увидеть то, что мы оставили в "совке" - обсчет, обвес, обман, "пересортица" (выдавание одного сорта за другой), несвежие продукты (а скоропортящемуся продукту трудно остаться свежим, если он приехал в обычном контейнере) и т.п... Повторяю - далеко не все "русские" магазины заслужил право на красный вымпел с надписью "Ностальгия". Именно такой магазин был у Алекса Я. Он старался честно обслуживать своих покупателей, не торговал гнильем, не покупал в России и на Украине за копейки просроченный товар... Из этого, дорогие мои читатели, уже можно понять, что дела у него шли неважно.... Итак, нашему герою срочно нужен был какой-то товар, который позволил бы быстро поправить дела. То есть дешевый, качественный и пользующийся повышенным спросом. Один из "жучков", крутящихся в Тель-Авиве, предложил Алексу крупную партию красной икры из-под Хабаровска. Дешево и сердито, икра хорошая, вкусная, оплата по факту поставки.
Алекс согласился... В условленный срок он приехал на небольшой склад, распложенный где-то в трущобах Южного Тель-Авива. Поставщик показал ему ящики с аккуратными банками икры.
- Годится?
- Погоди, дай попробовать... Алекс не поленился, открыл ящики, достал несколько банок наугад с самого низу...

В банках действительно оказалась икра, крупная - икринка к икринке. Правда, на вкус продукт чуть горчил, но не настолько, чтобы его уж совсем нельзя было есть.
- Беру! - согласился Алекс. - А почему такая крупная? Это что, "чернобыльский лосось"?
- Чавыча! - коротко ответил поставщик. - Самая крупная из красной рыбы. В длину достигает полутора метров - потому и икра соответствующая. Хотите еще пару баночек открыть или так брать будете?
Цена для красной икры была очень невысокая, и Алекс "затарился" по максимуму. В магазине покупатели быстро распробовали чудо-икру и стали энергично раскупать товар...

Среди клиентов Алекса был один мужичок, некогда биолог (или учившийся на биолога)... Алекс его ценил за рассудительность и обширные познания.
Как-то этот биолог зашел в магазин... и принялся выбирать закуску.
- Икорки хочешь чавычовой? - предложил Алекс. - Тебе, как другу, могу отдать совсем дешево - по себестоимости, за сколько сам брал.
- Чавычовую сроду не пробовал, -облизнулся биолог. - У нас в Союзе ее совсем мало добывали.
Взяв с собой бутылочку и закуску, довольный клиент удалился. А на следующий день после работы ворвался в магазин Алекса с криками:
- Ты чем же это народ кормишь?!
- Т-с-с, не кричи! - взмолился Алекс. -В чем дело? Тебе что, банка несвежей икры попалась? Так я заменю!
- Не надо мне менять! - ответил биолог. - Это вообще не икра! Точнее, икра - но не рыбная!
Короче говоря, в банках оказалась лягушачья икра, подкрашенная пищевым красителем. Непрофессионал никогда не отличит ее от рыбьей - разве что лягушачья икра гораздо крупнее и чуть горчит.
Чавычи в России добывается мало, и ее икра - большая редкость. А вот лягушек в болотах под Хабаровском летом видимо-невидимо. Предприимчивые люди давно наладили там сбор лягушачьей икры, которую закатывают в банки с надписью "красная" и продают за рубежом своим бывшим соотечественникам, испытывающим ностальгию.
Итак, если вы, уважаемый читатель, решили полакомиться икоркой, позволю себе дать вам несколько советов.
Первое: икру берите только мелкую, лососевую. Она должна быть интенсивно красного цвета и не горчить.
Второе: если вы уже наелись лягушачьей икры, то не расстраивайтесь. Она хотя и некошерна, но вполне съедобна. Мало того, китайцы считают лягушачью икру верным средством для продления жизни. И лопают ее, совсем не перегружая себя вопросом о том, кто снес эту икру - рыба или лягушка.
Поскольку, как уже было сказано, чавычовой икры Россия добывает очень немного, если вам попались очень уж крупные икринки, то следует насторожиться. Впрочем, единственный вред для здоровья может в этом случае исходить от красителя, да и то вероятность не слишком велика.
Кроме того, если вам продадут лягушачью икру вместо красной, вы сможете испытать чувство здоровой ностальгии по магазинам советской эпохи. Правда, красной икры там не было, а вместо хорошей картошки вам подсовывали гнилую, но мы ведь говорим не о продукте, а о чувстве, которое, согласитесь, подделать невозможно.



Игрек
- Tuesday, February 27, 2007 at 11:33:59 (PST)

Беру

Вопрос, на который я пообещал Вам ответить, тянет на статью. Времени же нет совершенно, поэтому постараюсь ответить очень схематично. Во-первых, каких убеждений этот самый Paul Johnson Вы можете понять прочитав первые восемь страниц из его книги “A History of the Jews” (Harper Perennial, 1988), если в Amazon наберете данные книги и залезете «inside of the boоk». К сожалению, вопрос об Исходе обсуждается на двадцатых страницах и прочесть их нельзя. Общий его подход к проблеме совершенно подобен подходу Великовского: он, исходя из истинности Торы, пытается совместить все возможные историко-этнографически-художественно-мифологически-лингвистически-геологически-астрономические данные исраэлитов, народов БВ, СВ и египтян. То есть рассматриваются и анализируются те же источники, что и Великовского: с египетской стороны - Amarna letters (-1389-1358), Tale of the two brоthers (-1225), Laiden’s papyrus, Leningad’s papyrus и так далее; с еврейской стороны – ВСЯ Тора (включая, например, песнь Деворы из Судей, отдаленая по времени, но считающаяся одной из старейших частей Книги), с христианской (и одновременно – с СВ) – книги Флавия, Филона Александрийского, Евсевия и так далее. В этой связи автор находит много подтверждений того, что не все исраэлиты ушли в Египет, в частности в городе Шехем и вокруг него евреи жили непрерывно, как и в некоторых других частях земли хаананской. Тут я должен признать, что в предыдущем постинге был не прав. Не некоторые колена остались в Хаане, а ПРЕДСТАВИТЕЛИ МНОГИХ колен остались там. Поэтому, в частности, живущие в Египте всегда имели СВОИХ в землях хаананских и даже, скорее всего, свою землю. В частности известны факты (есть ссылка), когда оставшиеся исраэлиты ВО ВРЕМЯ ЕГИПЕТСКОГО ПЛЕНЕНИЯ воевали и захватывали города на обещанной им Б-ом земле.
По поводу двенадцати колен. Автор указывает, что хотя цифра 12 была «общим местом» в мифологии того времени и для евреев и для ишмаэлитов, и для многих культур позднего бронзового века (у Ишмаэля, Нахора, Joktan, Esau и Иакова – у всех было 12 детей) и несмотря на то, что в Деворе упоминается только десять, автор уверен в конечной правде Книги.
То есть, на мой взгляд, автор весьма бережно (подобно уважаемому АК) относится к еврейским источникам, прежде всего – Торе, нигде не выпячивая некоторые незначительные нестыковки с СЕГОДНЯШНИМ знанием.
Что меня неприятно удивило, так это полное отсутствие имени Великовского на страницах книги, хотя историографическая часть ее написана в русле открытий Великовского.
Что меня еще неприятно удивило, так это Ваше разделение исследователей вопросов библейской хронологии на евреев и всех остальных. Согласно этой логики в опере должны петь сплошь итальянцы, а на балалайках играть только жители рязанской губернии.
Надеюсь, что хотя бы частично ответил на Ваши вопросы.




Victor-Avrom
- Tuesday, February 27, 2007 at 11:21:19 (PST)

Матроскин (размышлизм)
Первым и самым главным показателем благополучия зверушков в зоопарке является показатель их воспроизводства.
Судя по всему, евреям в Египте быо очень хорошо, то есть египтяне относились к ним чрезвычайно дружественно.


Но ещё лучше, вероятно, относились к евреям в царской России, когда численность евреев росла огромными темпами.


Испр.
- Tuesday, February 27, 2007 at 11:10:00 (PST)


...уникальное явление в замкнутом бассейне запечатлелось в народной памяти...


Владимир Вайсберг
- Tuesday, February 27, 2007 at 11:03:49 (PST)

Из того же источника: годы жизни Иосифа 1561 - 1451 до н. э.
Желаю успеха!


М. ТАРТАКОВСКИЙ.
- Tuesday, February 27, 2007 at 11:02:37 (PST)


Матроскин (размышлизм)
Первым и самым главным показателем благополучия зверушков в зоопарке является показатель их воспроизводства.
Судя по всему, евреям в Египте быо очень хорошо, то есть египтяне относились к ним чрезвычайно дружественно.
Если "10 казней египетских" суть последствия мега извержения вулкана Санторини, то в Египте создалась ситуация "спасайся, кто может!". С учетом сложившихся добрых отношений, почему было не объединить усилия в бегстве из умирающей страны в поисках нового пристанища? Тем более, что при совпадении всех остальных интересов, коммуникационных проблем не должно было быть.
Матроскин (размышлизм №2)
При объединении для эмиграции однозначно становятся объяснимыми ранее вопросительные 600 000 воинов.

>>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

Более известный размышлизм Неуловимого Джо /две недели тогда не сдавал он позиций!/ состоял в следующем: хан Чингис и эмир Тимур, разделённые пространством и временем /тысячи километров, сотни лет!/ - одно и то же лицо!

И в «Заметках», и здесь, в гостевой, я не раз обосновывал /пытался обосновать/ своё предположение, касающееся Исхода. Разумеется, вулканический взрыв острова Тира не был и никак не мог быть непосредственной причиной этого события.
Просто, уникальное явление в замкнутом бассейне запечатлелся в народной памяти – и, полагаю, отражён в тексте Торы, - о чём я писал с понятной осторожностью.

Есть очевидные загадки в положении евреев в «египетском рабстве» /одалживают золотые украшения у египтян и т.п./.

Радикальнейшая революция Эхнатона – уникальное событие древности. Его кончина и последовавшая затем столь же радикальная контрреволюция совпадает во времени с Исходом.

Уникальны и отношения фараона с женой Нефертити, которая, вероятнее всего, была иноземкой; согласно моему предположению – еврейкой...
(Не удержусь от одного - совершенно «по касательной» - свидетельства Григория Явлинского в день смерти Раисы Максимовны:
- Я задал Михаилу Сергеевичу вопрос: как пришло ему в голову освободить людей от уголовной ответственности за самый строй мысли, - с чего началось всё?
- А разве вы не знаете, что у моей жены образование философа...
И ссылка рассказчика на охранника Горбачевых: "Часами ходили они (супруги) по лесу, всё что-то обсуждали, обсуждали...")

Невероятные для Др.Египта установления Эхнатона как бы списаны /частично/ со страниц Торы – тогда, когда не было не только Книги, не было ещё и самих Скрижалей...
И т.д. Об этом в моей работе «Откровение Торы».

Наш т.с. эрудит, напрочь лишённый творческих способностей /расходующий своё безразмерное безделье на копание во всяких случайных источниках/, время от времени перевирает написанное мной. И не только мной.
Кстати, «объяснимые ранее вопросительные 600 000 воинов» - просто ерунда.
Об этом я писал не раз. Повторяться не буду.



Религия света
- Tuesday, February 27, 2007 at 10:57:59 (PST)

«И ты повели сынам Израиля, и они доставят тебе чистого оливкового масла, выжатого из маслин, для освещения – чтобы зажигать светильник, горящий постоянно. В Шатре Собрания, снаружи от разделяющей завесы, которая перед Ковчегом откровения, будут зажигать его Аарон и сыновья его, чтобы горел он с вечера до утра перед Господом, - это вечный закон им для всех их поколений от сынов Израиля. (Шмот 27:20-21)»
Внутри большого раздела, который посвящен заповедям, относящимся к конструкции походного Храма - Мишкана и изготовлению его деталей – Ковчега, стола, меноры, медного жертвенника и т.д., внезапно появляется повеление функционального характера, касающееся ежедневного храмового служения – зажигания Меноры. Фраза, содержащая заповедь, в нескольких отношениях отличается от того образца, который мы находим в аналогичных местах Торы. Этот раздел, как и предыдущий, "Трума", открывается повелением, данным сынам Израиля: сделать пожертвования на строительство Мишкана и для нужд совершаемой в нем службы. Однако обратите внимание на разницу в их изложении:
«Скажи сынам Израиля, и они доставят тебе...» (Шмот 25:2)
«И ты повели сынам Израиля, и они доставят тебе... » (Шмот 25:20)
Мудрецы указывали на следующую особенность: в тексте Священного писания некоторые заповеди открываются глаголом – «повели», а в большинстве остальных случаев – «скажи». «Скажи» - означает: скажи сейчас. Например, скажи как сделать Ковчег, жертвенник – сделать один раз и надолго.
"Повели" – повеление относится и к настоящему, и к будущему. Повели приносить масло, и сейчас, и ежедневно, и всегда масло надо приносить и Менору зажигать. И события, отмечаемые в Хануку, показывают, как мы выполняли эту заповедь много столетий спустя после смерти Моше.
Есть и еще одно важное отличие. Вот как выглядят другие распоряжения, данные в этом разделе:
«Жертвенник на земле сделай МНЕ...» (Шмот 20:21)
«Пусть возьмут приношение для МЕНЯ...» (Шмот 25:2)
«И сделают МНЕ святилище...» (Шмот 25:8)
Раши комментирует это так: «Мне» означает: «ради святости моего имени».
И явным диссонансом звучит:
«И ты повели сынам Израиля, и они доставят ТЕБЕ...» (Шмот 25:20)
То есть, все создание Мишкана делается «ради святости имени» Всевышнего, а постоянные приношения чистого масла и зажигание Меноры необходимо лично для Моше, Аарона и его потомков – священнослужителей.
Комментируя эту особенность, наши мудрецы обьясняли, что все повеления Всевышний давал Моше именно в светлое время суток, «...днем, когда Господь говорил с Моше...» (Шмот 6:28). Тем не менее, все время, пока горели храмовые лампады, внутри Мишкана было светло как днем, и, стало быть, Господь мог говорить с Моше даже ночью. И поэтому сказано в Торе: «...и они доставят тебе...» – для твоей надобности. Разум человека чист и ясен при ярком освещении, а свет ассоциируется с радостью. Все это было необходимо для того, чтобы подготовить душу Моше к принятию Божественных слов, а этого можно было достичь, лишь пребывая в соответствующем расположении духа – в радости. И, одновременно, это прямое противопоставление темным языческим храмам Египта, где душой непосвященного овладевал страх и мистический трепет. И особенный, чистый, яркий свет оливкового масла совсем не похож на коптящие факелы средневековых мистерий. Еще одна особенность заповеди света – «...вечный закон им для всех их поколений от имени сынов Израиля» (Шмот 27:21). Не только для Моше и Аарона, но и для всех будущих поколений служение при ярком свете это закон, смысл которого нам всем известен. В отличие от других законов Храмовой службы, например законов о жертвоприношениях, исполнение которых временно приостановлено после разрушения Храма, отблеск света Меноры ушел вместе с нами в страны рассеяния, он наполняет Малый Храм – синагогу – когда зажигаются свечи субботней и праздничной службы, когда горят «суточные» свечи, сохраняющие огонь, зажженный в пятницу для праздника, начинающегося на исходе Субботы, когда весело подмигивает огоньками ханукия. И ложится этот отблеск свечей на белую скатерть субботней трапезы, и звучат над ней благословения, которые положено говорить при свете – не случайно говорили наши мудрецы, что стол еврея сегодня – его жертвенник.
И, сохранив этот свет, мы внесем его в Третий Храм.


Еврейское агентство (Сохнут) и концерн IDB жертвуют дополнительные 13 миллионов шекелей на образовательные проекты на севере
- Tuesday, February 27, 2007 at 10:55:53 (PST)

Так заявили вчера на совместном визите на севере Министр Просвещения Юли Тамир, глава Еврейского агентства "Сохнут" Зеэв Бельский и председатель концерна IDB Нохи Данкнер. Данное вложение является частью совместного проекта Сохнута и концерна IDB для жителей приграничных поселений севера и вокруг Газы.

В результате вчерашнего визита на севере вместе с Министром Просвещения, Зеэв Бельский и Нохи Данкнер приняли решение профинансировать следующие проекты:

Ремонт начальной школы "Ноам" в Тверии на общую сумму в 4.2 млн. шекелей.

Строительство образовательного комплекса в кибуце Равид на общую сумму в 2.5 млн. шекелей.

Вложение в проект "Боним Атид" (Строим Будущее) для образовательной работы с трудными подростками в Цфате, Хацор и Рош Пине на общую сумму в 2.5 млн. шекелей.

Ремонт школы в Цфате на общую сумму в 3.5 млн. шекелей.

Данное вложение является частью совместного проекта Сохнута и концерна IDB для жителей приграничных поселений севера и вокруг Газы в сферах просвещения, здоровья, социальных услуг, культуры и спорта. До настоящего момента вложены в рамках проекта 80 миллионов шекелей.

Зеэв Бельский сказал, что сотрудничество бизнес сектора, во главе с Нохи Данкнером, одним из наиболее влиятельных и успешных бизнесменов в Израиле, с публичным сектором, во главе с Еврейским агентством "Сохнут" и правительственными учреждениями, является ключом к успешному развитию периферии Израиля.

Нохи Данкнер добавил: "Коммерческие компании обязаны принять участие в развитии государства, и в частности севера и района вокруг Газы. Я горд внести свой существенный вклад в образование, совместно с Еврейским агентством (Сохнут)".

В последние годы Еврейское агентство "Сохнут" инициирует совместные проекты для развития Израиля с крупными бизнесменами Израиля, среди них Нохи Данкнер, Офра Штраус, Бени Ланда, Аркадий Гайдамак и Леонид Невзлин.

Для дополнительной информации:

Алекс Сельский, Пресс-секретарь по связям с русскоязычными СМИ. 052-3849090



Б.Тененбаум - Элле :)
- Tuesday, February 27, 2007 at 10:40:59 (PST)

Мой знакомый баварец был шокирован именно тем, что в Мюнхене жило так много такого разного народа, а не только баварцы и треклятые пруссаки :) Но со временем он переменил свои взгляды настолько, что женился на иранской художнице :) Сам он - математик, с докторской диссертацией по вычислительной химии. Он был у меня в гостаых в 1998, но в 2000 моя кампания, по работе в которой мы были связаны, развалилась, и связи наши как-то пресеклись.


Буквоед - АК
- Tuesday, February 27, 2007 at 10:38:06 (PST)

Уважаемый Анатолий! Недавно поступила информация о том, что Гусинский получил испанское гражданство, доказав свое сефардское происхождение. Если отвлечься от того, что с его деньгами можно доказать свое прямое происхождение и от пророка Мухаммеда, можно ли генетически определить, кто сефард, а кто нет? Спасибо.



Gena
- Tuesday, February 27, 2007 at 10:35:01 (PST)

AK
Boston, MA - Tuesday, February 27, 2007 at 08:30:15 (PST)


Значит, такая мутация возможна? Какое же численное значение приписывается получившемуся аллелю? 14? 15? 14.5?




Gena
- Tuesday, February 27, 2007 at 10:26:57 (PST)

АЕД
- Tuesday, February 27, 2007 at 10:02:17 (PST)

Gena - Tuesday, February 27, 2007 at 09:06:51 (PST)
что он считает Тору, включая комментарии наших мудрецов, без которых текст Торы часто непонятен

Гена,
А почему Вы сами себя в глупцы записываете?


Э-хе-хе...

Вы ведь атеист, АЕД. И сразу видно.

Вы наверное, не знаете, или не помните, что Моисей был скромнейшим из людей. И не удивительно, что Вы не стремитесь подражать Моисею хотя бы в этом одном, а ставите себя в один ряд с нашими мудрецами, да еще меня на это подбиваете. Нетушки.


Глава Тецаве
- Tuesday, February 27, 2007 at 10:26:05 (PST)

«Есть один народ, рассеянный и разбросанный среди народов» - народ, единство которого проявляется только на Земле Израиля. Для всех евреев любой праздник приходится на один и тот же день календаря, независимо от места их проживания. Не так в Пурим. Победа над врагами, собиравшимися уничтожить еврейский народ во всех провинциях Персии, отмечается в разное время: 14-го Адара теми, кто живет за пределами Иерусалима, и 15-го Адара теми, кто проживает в столице Израиля. Разделение праздника Пурим на два дня: один для жителей всех мест, а другой - для жителей Йерушалаима - призвано напомнить нам о том, что в странах рассеяния сыны Израиля не могут достичь единства и остаются «народом одним, рассеянным и разбросанным среди народов». Мудрецы выбрали праздник Пурим в качестве напоминания о раздробленности народа в изгнании потому, что из-за желания большей части евреев оставаться в странах изгнания исход из Вавилона стал не окончательным освобождением, а лишь этапом на пути к достижению свободы и независимости в будущем. В этом проявилась недостаточная любовь к Земле Израиля, святость которой раскрывается в полной мере только через Храм на горе Мория, возвышающийся в центре Йерушалаима. Если сердца наши будут крепко-накрепко связаны с Йерушалаимом и мечта о возведении Храма не оставит нас, мы превратимся в народ, объединенный общим стремлением, общим желанием и общей целью. Ничто другое, кроме желания приблизиться к святости, не может объединить еврейский народ. «И для евреев был и свет, и радость, и веселье..." Да будет так и в наше время!
Рав Дов Бегон



Буквоед - Иону Дегену
- Tuesday, February 27, 2007 at 10:18:58 (PST)

5. Приглашаю Вас, когда будете в Израиле. Я покажу Вам один из наградных листов. Вы прочтёте, сколько всего уничтожено, и за что получена аж медаль «За отвагу». И такое бывает.
---
Спасибо за приглашение, но с двумя детьми в колледже пока особо не разъездишься, так что Вы, если в Нью-Йорке будете, сигнал дайте и мы встретимся в моей деревне или в городе.



Матроскин
- Tuesday, February 27, 2007 at 10:18:13 (PST)

МИМОЛЕТОМ
- Tuesday, February 27, 2007 at 08:16:17 (PST)
Матроскину
Браво! Браво! Колоссально! Потрясающе!
Ваша острота об обрезании мамонтов многого стоит в части завершения вашего портрета.
+++++++++++++

Не понял, отчего такое экстремальное возбуждение? Мусульман обрезать можно, а мамонтов нельзя. Почему? А если мамонты приняли ислам?



Матроскин (для англоязычных)
- Tuesday, February 27, 2007 at 10:07:59 (PST)

Good evening, my fellow Jews.
>This article [PDF file] is about the leftist jews who wants to end the
>State of Israel.
>They live among us.
>They call themselves " progressive".
>
>We all remember from Moscow radio and TASS:
>"Sovetskie lyudi kak i vse progressivnoe chelovechestvo rezko osuzhdayut
>israilskuyu voenschinu!!"
>
>When I hear this word "progressive" [Jesse Jackson uses this word to
>describe his racist Rainbow Coalition] I am getting as allergic as I was
>when I saw banners in USSR " Slava KPSS".
>
>Lenin called them useful idiots.
>It is really a compliment, implying that they mean good, they just happen
>to be not too bright.
>In Lenin's time, I admit, that it coud have been the case.
>Those enthusiastic idealists, in pre-Gulag time, deceived by rosy prospects
>of workers paradise. Fine, I understand.
>
>But now????
>
>These jews in the article - almost all of them are overachievers - Ivy
>Leaguers, PhDs, tenured professors, prominent positions, "vlastiteli dum"
>so to speak.
>They could be compared to Capos [Jews who helped SS guards in Auschwitz],
>but those poor, weak souls were doing it hoping to be eaten last by the
>alligator. I can, probably, understand that too.
>
>I cry, often literally, over every dead Jew, here in US, Israel or
>elsewhere. There is not that many of us.
>
>But I will experience a quintessential schadenfreude [German for happiness
>at the misfortune of others] when any of these verminous traitors gets his
>due.
>Meir Kahane, where are you??
>They will kill us again.
>They are worse than Osama.
>Our children will not listen to him but they will listen to them.
>
>Forgive me the emotions, please.
>I am about to weep, already.
>
>Here is the article by a good man - Alvin H. Rosenfeld.
>It is called "Progressive" Jewish Though and the New Anti-Semitism and is
>about 20 pages long.
>
>http://www.ajc.org/atf/cf/%7B42D75369-D582-4380-8395-D25925B85EAF%7D/PROGRESSIVE_JEWISH_THOUGHT.PDF
>
>
>I implore you to read it in its entirety. Send the link to other Jews.
>Foreword was written by David Harris, with whom I had pleasure to meet in
>Rome's HIAS office in 1977. But thats for another email.



АЕД
- Tuesday, February 27, 2007 at 10:02:17 (PST)

Gena - Tuesday, February 27, 2007 at 09:06:51 (PST)
что он считает Тору, включая комментарии наших мудрецов, без которых текст Торы часто непонятен

Гена,
А почему Вы сами себя в глупцы записываете?


Ион Деген
- Tuesday, February 27, 2007 at 10:00:49 (PST)

Дорогой Буквоед!

Я сейчас в глухом лесу на северо-востоке Скалистых гор. Наслаждаюсь космической тишиной и метровым слоем снега. Но доступ к интернету, увы, резко ограничен. Поэтому отвечаю Вам с опозданием.
1. Все двигатели немецких танков работали на бензине.
2. Танк Т-3, считавшийся у немцев средним, имел очень слабую лобовую броню. О боковой и кормовой даже не говорю.
3. Не знаю, какое оружие было у кубанских казаков. Если имелись ПТРы, противотанковые гранаты (или связки гранат), бутылки с зажигательной смесью и, главное, грамотный и смелый командир эскадрона, сумевший хорошо подготовить позицию к обороне, уничтожить 28 танков задача тяжёлая, но осуществимая.
4. Не помню, сколько по статусу танков надо было уничтожить, чтобы получить звание Героя. Вообще-то всё зависело от обстановки и от представляющих к награде. Недавно в Израиле умер мой знакомый артиллерист, уничтоживший только один танк. Но какой подвиг совершил при этом! Он абсолютно заслужено получил Героя.
5. Приглашаю Вас, когда будете в Израиле. Я покажу Вам один из наградных листов. Вы прочтёте, сколько всего уничтожено, и за что получена аж медаль «За отвагу». И такое бывает.
Всего самого доброго!
Ваш И.Деген.



Ион Деген
- Tuesday, February 27, 2007 at 09:59:34 (PST)

Дорогой Буквоед!

Я сейчас в глухом лесу на северо-востоке Скалистых гор. Наслаждаюсь космической тишиной и метровым слоем снега. Но доступ к интернету, увы, резко ограничен. Поэтому отвечаю Вам с опозданием.
1. Все двигатели немецких танков работали на бензине.
2. Танк Т-3, считавшийся у немцев средним, имел очень слабую лобовую броню. О боковой и кормовой даже не говорю.
3. Не знаю, какое оружие было у кубанских казаков. Если имелись ПТРы, противотанковые гранаты (или связки гранат), бутылки с зажигательной смесью и, главное, грамотный и смелый командир эскадрона, сумевший хорошо подготовить позицию к обороне, уничтожить 28 танков задача тяжёлая, но осуществимая.
4. Не помню, сколько по статусу танков надо было уничтожить, чтобы получить звание Героя. Вообще-то всё зависело от обстановки и от представляющих к награде. Недавно в Израиле умер мой знакомый артиллерист, уничтоживший только один танк. Но какой подвиг совершил при этом! Он абсолютно заслужено получил Героя.
5. Приглашаю Вас, когда будете в Израиле. Я покажу Вам один из наградных листов. Вы прочтёте, сколько всего уничтожено, и за что получена аж медаль «За отвагу». И такое бывает.
Всего самого доброго!
Ваш И.Деген.



AK
Boston, MA - Tuesday, February 27, 2007 at 09:44:21 (PST)

>Gena, Tuesday, February 27, 2007 at 09:06:51 (PST)
>>Исааку
>>>Бер, Monday, February 26, 2007 at 15:26:32 (PST)
... для евреев, мало-мальски изучающих Тору ... нет никакого вопроса, никакой проблемы.... в хронологии всех библейских эпизодов. Она (хронология) разработана доскональнейшим образом еще тысячелетиЯ назад.
Подчеркиваю: РАЗРАБОТАНА, а не вымышлена, не высосана из пальца, ибо все необходимые сведения заложены в Торе изначально.
######################

К сожалению, я так и не получил даты рождения детей Иакова, пусть и в виде периода дат. Только чтобы непротиворечиво, хотя бы увязанные с приходом-Исходом.

Вот так всегда - ругают одни, а информацию дают другие. Хотелось бы ошибиться в данном случае.




Victor-Avrom
- Tuesday, February 27, 2007 at 09:34:55 (PST)

На Дика Чейни совершено покужение на американской авиабазе Баграм. Самоубийца взорвал себя у ворот базы, когда мимо проезжала машина с Чейни. Убито 20 человек, ранено 23. Чейни не пострадал. Талибан заявил о своей ответственности за атаку и подтвердил, что целью был американский вице.

http://www.msnbc.msn.com/id/17355517/

кремень!


Буквоед - Б.Тененбауму
- Tuesday, February 27, 2007 at 09:10:35 (PST)

Испания как национальное государство существует со времени Фердинанда и Изабеллы. И тем не менее каталонцы определенно считают себя не испанцами, а отдельным народом
---
Они "таки да" отдельный народ со своим языком, который ближе к французскому, чем к испанскому, культурой и прочим. Галисийский диалект ближе к португальскому, чем к испанскому. О басках я и не говорю. Интересно, что во время гражданской войны баски, фанатичные католики, практически поголовно сражались за "безбожную республику, созданную иудеями и масонами на английские деньги", т.к. эта самая республика впервые дала им автономию и возможность свободно пользоваться своим языком. Испания мне напоминает в этом плане Российскую империю или СССР. Интересно, что мои сотрудники латиноамериканцы говорят о государственном языке Испании не "испанский", а кастильский (castellanо), т.к. большинство из них (белых, конечно) происходит от басков, каталонцев и др. А вот про свой язык они говорят "испанский".



Gena
- Tuesday, February 27, 2007 at 09:06:51 (PST)

Исааку:

Бер
- Monday, February 26, 2007 at 15:26:32 (PST)
... для евреев, мало-мальски изучающих Тору ... нет никакого вопроса, никакой проблемы.... в хронологии всех библейских эпизодов. Она (хронология) разработана доскональнейшим образом еще тысячелетиЯ назад.
Подчеркиваю: РАЗРАБОТАНА, а не вымышлена, не высосана из пальца, ибо все необходимые сведения заложены в Торе изначально.
Тора – в отличие от многочисленных других мировоззренческих построений – не миф, а ТОЧНО ЗАДОКУМЕНТИРОВАННАЯ ИСТОРИЯ. Иной она и не может быть, т.к. открыто претендует на функцию весьма конкретного конспекта-плана сотворения мира. В ней приведены ясные и однозначные цифры лет отцов при рождении их первенцев (а где надо – и не только первенцев, а вдобавок и сынов-не-первенцев, если таковые являются важнейшими узлами родословия евреев) – буквально всех, начиная от Адама. Именно благодаря этому еврейскими мудрецами просчитана точная хронология по всей нашей истории.


Я не могу быть полностью уверенным, что правильно понял Бера, но у меня слозилось впечатление, что он считает Тору, включая комментарии наших мудрецов, без которых текст Торы часто непонятен, истиной в том же смысле, в котором истинно равенство 2+2=4. На это я и отреагировал: если бы это было действительно так, то, в частности, не было бы никаких противоречий между нашей и христианской хронологиями, т.к. во владении арифметикой христиане нашим мудрецам уж точно не уступают.

Да, пост Бера информативен, и я за это ему благодарен, как и Вы.


Исаак
- Tuesday, February 27, 2007 at 08:49:24 (PST)

Уважаемый Gena. Не могли бы Вы указать конкретно в чём не прав Бер. Какие из его утверждений, основанных на Торе и комментариях к ней, представляются Вам неверными и почему? По-моему постинги Бера являются наиболее обоснованными из всех, помещенных здесь в связи с вопросом хронологии пребывания евреев в Египте. Я искренне благодарен ему за его ясные и нетривиальные ответы. В частности, включающие в себя ранее неизвестные мне эпизоды Исхода. Хотелось бы услышать комментарии по этому поводу от уважаемого Онтарио


Элла
- Tuesday, February 27, 2007 at 08:39:46 (PST)

а мой знакомый баварец утверждал, что пережил "культурный шок", переселившись в Мюнхен из Пиллау

Про баварское своеобразие ходит множество анекдотов. Вот один из них:

Поссорился на какой-то выставке баварец с японцем и орет на него: "Свинья эдакая! Пруссак ты японский!"


AK
Boston, MA - Tuesday, February 27, 2007 at 08:30:15 (PST)

>Gena, Tuesday, February 27, 2007 at 08:15:08 (PST)
>...легко могу представить себе множество мутаций маркеров, которые, по-видимому, не происходят. Например, аллель, состоящий из 15 ТАGА, теоретически может мутировать так: первые семь ТАGА без изменений, восьмой превращается в ТА, последние семь без изменений:
Но такие мутации, по-видимому, не происходят. Почему?
#####################

Происходят самые разнообразные мутации и в самых разнообразных частях Y-хромосомы ДНК, как и в других хромосомах. На это счет публикуются сотни, если не тысячи научных статей. На самом деле известны и применяются для тонких генеалогических исследований более 200 маркеров. Мы здесь обсуждаем только шесть, как наиболее простых и показательных, и наиболее хорошо изученных.

Во всем нужна мера, говоря изысканно - оптимизация. Можно рассматривать и один маркер, но тогда в число 14 попадут и евреи, и арабы, и англичане, и норвежцы, и многие другие. Это как бы штангенциркуль, зажатый винтом в одной позиции. Есди брать 37 маркеров, не говоря о 59, то об изучении популяций говорить не приходится. Это будет такое сито, что захват будет только ближайших родственников.

На мой вкус, шесть маркеров - вполне достаточно для основных, принципиальных рассмотрений. Некоторые используют восемь или одиннадцать, но там за деревьями часто не видно леса.




МИМОЛЕТОМ
- Tuesday, February 27, 2007 at 08:16:17 (PST)

Матроскину
Браво! Браво! Колоссально! Потрясающе!
Ваша острота об обрезании мамонтов многого стоит в части завершения вашего портрета.
Дерзайте дальше. Еще осталось 612 Заповедей и над каждой вшивому и блохастому коту можно посмеяться и поострить на потеху таким же сотоварищам.
Но..."смеется тот, кто смеется последним".
Все еще впереди, необрезанный яврейский кот...


Б.Тененбаум - Е.Берковичу, Игреку,Буквоеду
- Tuesday, February 27, 2007 at 08:16:08 (PST)

Возможно, вообще поговорить о сравнительной истории стран Европы было бы интересным делом. Испания как национальное государство существует со времени Фердинанда и Изабеллы. И тем не менее каталонцы определенно считают себя не испанцами, а отдельным народом. В Италии - 14 равноправных диалектов, южане и северяне не вполне понимают друг друга, настолько ментальность миланца отличается о ментальности сицилийца, а мой знакомый баварец утверждал, что пережил "культурный шок", переселившись в Мюнхен из Пиллау.
В под-бостонье русские эмигранты делились не только на "волны", что естественно, но и на землячества - "московско/ленинградские", "украинское, кроме Киева", "киевское", "львовское", и т.д. Правда, лет так через 10 они слились в нечто более или менее единое :) Наверное, похожие процессы все еще идут в Израиле ?


Gena
- Tuesday, February 27, 2007 at 08:15:08 (PST)

Уважаемый АК,

У меня к Вам химический вопрос, который уже давно вертится в голове.

Я, как человек, далекий от химии, легко могу представить себе множество мутаций маркеров, которые, по-видимому, не происходят. Например, аллель, состоящий из 15 ТАGА, теоретически может мутировать так: первые семь ТАGА без измененний, восьмой превращается в ТА, последние семь без изменений:

TAGATAGATAGATAGATAGATAGATAGATATAGATAGATAGATAGATAGATAGATAGA

Но такие мутации, по-видимому, не происходят. Почему?


Gena
- Tuesday, February 27, 2007 at 08:07:01 (PST)

Уважаемы Онтарио,

Большое спасибо за ответ. Я не знал, что по этому вопросу существуют разногласия. Спасибо за информацию. Я обязательно прочитаю указанное место в Мишней Тора.


Gena
- Tuesday, February 27, 2007 at 08:01:16 (PST)

Бер,

Вы религиозный человек, знаете Тору, честь Вам за это и хвала.

Но несмотря на Вашу образованность, Вы, похоже, никогда не слышали о такой вещи как библейская критика. А ведь эта "вещь" существует уже больше 300 лет, у её истоков стоял "наш человек" - Спиноза.

Не мешает знать о таких вещах, и как часть нашей истории, и как часть общего образования, чтобы не ставить себя в нелепое положение, как Вы себя сейчас поставили, утверждая, что всё в Торе, по крайней мере в области хронологии, досконально разработано, и никаких противоречий нет. Если бы это было действительно так, то не было бы во-первых, никаких разногласий между нашими комментаторами, во-вторых, светские библеисты остались бы без работы, и в третьих, противоречия между нашей и христианской хронологиями улетучились бы, потому, что христиане опираются на тот же текст, что и мы. Или Вы считаете, что у христиан с арифметикой такие проблемы, что они, в отличие от наших мудрецов, не способны правильно складывать и вычитать приводимые в Торе даты?


АЕД
- Tuesday, February 27, 2007 at 08:00:58 (PST)

Раввин арестован за критику генерала

Как следует из самой статьи, раввин арестован не за критику генерала, а за отказ явиться к следователю. Если бы он был арестован за критику, то был бы арестован сразу. К тому, что журналисты весьма часто перевирают события, уже все привыкли, но давайте не распространять эту ложь добровольно и бескорыстно.


АЕД
- Tuesday, February 27, 2007 at 07:18:27 (PST)

Матроскин - Tuesday, February 27, 2007 at 06:08:01 (PST)
А мне кажется, что они могли бы тогда затрахать всех едоков. :)

Вы хотите сказать, что все обрезанные трахают необрезанных? Так это и так очевидно. Но как показало время, обрезанные мастодонты вымерли.


Камнекидание в Самарии: пострадала израильтянка
Израиль - Tuesday, February 27, 2007 at 06:53:33 (PST)

17:59 26 Февраля 2007

Возле деревни Дума к северо-востоку от поселения Швут-Рахель арабские боевики швыряли камни в израильский автомобиль, следовавший по шоссе Алон. В результате жительница поселения Мигдалим пережила травматический шок. Фельдшер направляется для оказания ей первой помощи. Стекло ее машины разбито.




Арестованы убийцы Эреза Леванона
Израиль - Tuesday, February 27, 2007 at 06:52:21 (PST)

18:18 26 Февраля 2007

Только что разрешена к публикации тнформация о том, что в 2:00 ночи в понедельник (26 февраля) бойцы спецподразделения "Шимшон" задержали двоих арабских террористов, которые убили накануне Эреза Леванона из поселения Бат-Аин.

Это двое 17-летних жителей села Бейт-Уммар: Мудар Абу-Дайе и Муса Кукас.



В Берлине атакован еврейский детский сад
- Tuesday, February 27, 2007 at 06:50:21 (PST)

19:00 26 Февраля 2007

Неизвестные совершили нападение на детский сад для еврейских детей в столице Германии. Об этом сообщили агентству "Рейтер" из берлинской полиции.

Нападавшие изрисовали здание граффити с антисемитскими лозунгами. Полиция опрашивает свидетелей, которые могли видеть, как злоумышленники бросили в окно садика горящий предмет.



В Иудее и Самарии поймано 13 боевиков
Израиль - Tuesday, February 27, 2007 at 06:48:00 (PST)

07:23 27 Февраля 2007

В ночь на вторник (27 февраля) военнослужащие ЦАХАЛа задержали в Иудее и Самарии 13 находившихся в розыске арабских террористов.

В Хевроне и окрестностях пойманы четверо членов ХАМАСа и один - «Исламского джихада». В районе Бейт-Лехема пойманы трое террористов. Один хамасовец взят возле Рамаллы.



Атака на солдат возле Газы
Израиль - Tuesday, February 27, 2007 at 06:45:48 (PST)

12:16 27 Февраля 2007

Арабские боевики открыли огонь по укрепленному пункту ЦАХАЛа, оборудованному между киббуцем Кфар-Аза и «разделительным забором», проходящим по восточной кромке сектора Газы.



Имя погибшего летчика – Гидеон Шатиль
Израиль - Tuesday, February 27, 2007 at 06:44:31 (PST)

12:59 27 Февраля 2007

Разрешено к публикации имя пилота самолета сельскохозяйственной авиации, распылявшего удобрения и потерпевшего крушение над полями Изреэльской долины к востоку от Афулы. Это 61-летний Гидеон Шатиль из Тель-Адашим.



Ракетный обстрел Негева продолжается
Израиль - Tuesday, February 27, 2007 at 06:40:02 (PST)

15:12 27 Февраля 2007



Вторая с начала дня (27 февраля) ракета "касам" выпущена арабскими боевиками из сектора Газы по Западному Негеву. Снарядов разорвался возле одного из киббуцев на территории регионального совета Шаар-ха-Негев. О наличии ущерба и пострадавших пока сведений нет.



«Жаркая зима»: проблема террора имеет военное решение!
Израиль - Tuesday, February 27, 2007 at 06:35:09 (PST)



Bomb laboratory Shchem

[12:02 26/02]

Начатая утром 25 февраля сухопутная операция ЦАХАЛа в Шхеме («Жаркая зима») проходит успешно: арестовано несколько разыскиваемых террористов, обнаружены и ликвидированы лаборатории по производству взрывчатки. В настоящий момент израильские военнослужащие блокируют несколько домов, в которых, по всей вероятности, все еще укрываются диверсанты.

подробнее...
http://www.sedmoykanal.com/news.php3?id=222953



"Эрез был скромным, творческим, музыкальным человеком"
Израиль - Tuesday, February 27, 2007 at 06:29:43 (PST)

12:41 26 Февраля 2007



Erez Levanon

Убитый сегодня ночью террористами возле Хеврона 42-летний Эрез Леванон был браславским хасидом, в традициях которых – уединяться для молитвы в тихом месте на час-полтора в день. Эрез нашел себе такое пасторальное место в лесу и приезжал туда каждый день. Видимо, террористы выследили его и вчера совершили нападение.

Судя по результатам расследования, нападавших было двое: сначала они заговорили с Эрезом и отвели его в сторону, а потом закололи ножом.

У Эреза остались жена и трое детей.

Друг Эреза Мики Йосефи рассказал в интервью радиостанции «Коль-Хай», что он был тихим, скромным и очень одухотворенным, творческим, музыкальным человеком. Он писал стихи, музыку и сам же исполнял свои песни. Выпустил диск.

Похоронная процессия убитого террористами возле Хеврона Эреза Леванона, Да будет благословенна память о нем и Да отмстит Всевышний за его кровь, выйдет сегодня в 14:00 из поселения Бат-Аин и направится к кладбищу в Кфар-Эционе.


http://www.sedmoykanal.com/news.php3?id=222955



Депутаты требуют судить профессора за «кровавый навет"
Израиль - Tuesday, February 27, 2007 at 06:23:37 (PST)

10:48 27 Февраля 2007



Ariel Toaf

Депутаты Кнессета требуют предать суду профессора Университета Бар-Илан Ариэля Тоафа, автора опубликованной в Италии книги «Пасхальная кровь», в которой «исследуется» вопрос об «исторических доказательствах» многовековых обвинений евреев в использовании христианской крови в ритуальных целях.

подробнее...
http://www.sedmoykanal.com/news.php3?id=223015



Раввин арестован за критику генерала
Израиль - Tuesday, February 27, 2007 at 06:17:15 (PST)

11:37 27 Февраля 2007



Amona

Как сообщает агентство "Коль Рина", несколько минут назад иерусалимская полиция арестовала известного раввина Исраэля Ариэля, который возглавляет раввинский суд, основанный при Сангедрине (Синедрионе) и занимающийся проблемами еврейского народа и Государства Израиль.

Недавно законоучитель написал командующему Центральным военным округом Яиру Наве нелицеприятное письмо. Религиозный авторитет пошел на этот шаг после того, как генерал наотрез отказался предстать перед раввинским судом, разбирающим поданные против него гражданские иски.

В своем послании раввин обратил внимание Наве на то, что его действия (в их числе издание административных ордеров, запрещающих десяткам поселенцев находиться на территориях Иудеи и Самарии, в том числе у себя дома) могут подпадать под категорию доносительства.

Получив это письмо, полиция вызвала рава Ариэля на допрос. Тот явиться отказался, заявив, что следствие против него возбуждено с целью запугать возглавляемую им судейскую коллегию, и он не собирается идти у следователей на поводу.

И вот во вторник 27 февраля р. Ариэля задержали в столице "блюстители порядка". Комментарий приближенных законоучителя: "Мы вернулись в ту темную эпоху, когда раввинов преследовали за издаваемые ими галахические постановления".



Арестована банда арабов, насиловавших еврейских девушек
Израиль - Tuesday, February 27, 2007 at 06:15:23 (PST)

14:18 27 Февраля 2007

Во вторник 27 февраля Назаретский мировой суд разрешил публикацию информации о том, что шестеро жителей арабской деревни Бир-аль-Максур, расположенной между Шфаръамом и Назаретом, арестованы по подозрению в членстве в банде, совершившей за последние 2 года как минимум 4 групповых изнасилования. Им же инкриминируется похищение тремпистки в районе Хайфы.

Среди изнасилованных этой бандой имеются женщина 20 с небольшим лет от роду, военнослужащая ЦАХАЛа, а также 16-летняя и 13-летняя жертвы. Анализы ДНК подтвердили, что преступления совершались именно этими субъектами.



Борис Михайлович
- Tuesday, February 27, 2007 at 06:11:41 (PST)

Я бы добавил еще один важный фактор, отличающий Италию от Германии, - это отсутствие "светских" антисемитских традиций

при этом не нужно забывать, что слово "гетто" - итальянского происхождения, и первое гетто случилось в Италии.



Матроскин
- Tuesday, February 27, 2007 at 06:08:01 (PST)

АЕД
- Tuesday, February 27, 2007 at 05:48:45 (PST)
ъ ъ ъ ъ ъ ъ

А мне кажется, что они могли бы тогда затрахать всех едоков. :)


АЕД
- Tuesday, February 27, 2007 at 05:48:45 (PST)

Матроскин - Tuesday, February 27, 2007 at 05:46:48 (PST)
Интересно, вот если бы мамонты делали обрезание, они бы дожили до наших дней?

Нет, они были похоронены под своею же крайней плотью.


Буквоед - Е. Берковичу, Игреку, Б. Тененбауму
- Tuesday, February 27, 2007 at 05:48:08 (PST)

То, что двигало итальянцами в отношении евреев в годы фашизма, можно было бы назвать "банальностью добра". В душах многих людей сохранился определенный порог порядочности, перейти который они не могли даже по приказу дуче. Престиж нации, совесть и человечность оказались не пустыми словами для многих итальянцев -- от простых солдат до генералов и министров.
---
Я бы добавил еще один важный фактор, отличающий Италию от Германии, - это отсутствие "светских" антисемитских традиций: если идеологи германского единства в большей или меньшей степени были антисемитами, то этого ни в коем случае нельзя сказать ни о Мадзини, ни о Кавуре, ни о Гарибальди. Недаром кто-то сказал, что до объединения Италия была самой худшей страной для евреев, после - нет страны в Европе, где евреям было бы лучше, чем в новой Италии.



Матроскин
- Tuesday, February 27, 2007 at 05:46:48 (PST)

Обрезание исключительно полезно для здоровья
- Tuesday, February 27, 2007 at 04:35:22 (PST)
х х х х х х

Интересно, вот если бы мамонты делали обрезание, они бы дожили до наших дней?


Борис Михайлович
- Tuesday, February 27, 2007 at 04:54:56 (PST)

Ontario14
- Tuesday, February 27, 2007 at 04:46:49 (PST)


Вы думаете, Виктор Б. тоже хохмил? Ну, и шутки у вас, боцманов...


Матроскин
- Tuesday, February 27, 2007 at 04:54:05 (PST)

В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов
- Tuesday, February 27, 2007 at 04:32:31 (PST)
х х х х х х

Наконец-то выяснилось, куда подевались мамонты! А то все "эволюция, эволюция"...


Ontario14
- Tuesday, February 27, 2007 at 04:46:49 (PST)

Борис Михайлович
- Monday, February 26, 2007 at 22:55:39 (PST)
В письменной вроде не говориться о краже краже людей.
*******
Говориться.

Дмитрия Сергеевича нет сейчас с нами, но слог его живет: нет мягкого знака в глаголах, отвечающих на вопрос "что делают?", "что делает?". Иначе чистая русофобия, правильно тут товарищ предупреждал.

*******
нам не дано предугадать как хохма наша отзовётся...(БМ, специально для Вас - я знаю как эта строка звучит в оригинале)
"Не знаю, может это от города зависит ? В Харькове выступал - хватало междометий - ржали 3 часа. А проехал оттуда в Тамбов... Хоть и не так далеко... Но это ж просто мордой об забор"(ММЖванецкий)


Обрезание исключительно полезно для здоровья
- Tuesday, February 27, 2007 at 04:35:22 (PST)

Доктор Энтони Фаучи (Dr Anthony S. Fauci), главный вирусолог Соединенных Штатов, руководитель Института аллергии и инфекционных заболеваний (Director of the National Institute of Allergy and Infectious Diseases) прокомментировал результаты исследования, показавшего исключительную эффективность обрезания как средства предотвращения передачи вируса иммунодефицита: «Если бы нам удалось создать вакцину столь же эффективную, как эта процедура, о ней бы заговорил весь мир».

Согласно окончательным данным масштабного исследования, проведенного в нескольких африканских странах, только что опубликованного журналом «Ланцет» (The Lancet), обрезание предотвращает заражение СПИДом в 65% случаев, что выше самых смелых надежд специалистов.

Можно ли сказать, что после 25-летних безуспешных поисков вакцины от ВИЧ инфекции была найдена процедура, которая способна ее заменить? С этим вопросом мы обратились к профессору медицины, вирусологу Даниилу Голубеву:

— Да, эффективность процедуры обрезания свидетельствует о том, что вероятность заражения у обрезанных оказывается на 50-60% ниже, чем у необрезанных. Это цифра, которую хорошо бы достигнуть с помощью вакцины, если бы она была.
http://www.svobodanews.ru/Article/2007/02/26/20070226172928033.html


В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов В верхнем палеолите население Русской равнины съедало в год до 10 тысяч мамонтов
- Tuesday, February 27, 2007 at 04:32:31 (PST)

Сытые люди смогли думать и работать намного продуктивней, подчеркивает Роберт Фогель. Оно и понятно, как отмечает известный российский эксперт в области антропологии питания Андрей Козлов, «все большая доля энергии стала использоваться для питания очень крупного, по сравнению с другими животными, мозга: у низших обезьян на поддержание работы мозга приходится 10–13%, а у человека около 20% от общего объема энерготрат организма». Путь к этому мозговому раю у представителей вида homo sapiens был весьма тернист. Андрей Козлов приводит ряд поразительных фактов.

Согласно расчетам известного советского палеонтолога Н.К.Верещагина, в эпоху верхнего палеолита годовой объем добычи охотничьих групп, обитавших на территории Русской равнины и Крыма (10–15 тыс. человек), мог быть эквивалентен 120 тыс. северных оленей, 80 тыс. лошадей, 30 тыс. бизонов или 10 тыс. мамонтов.

Мало того, оказывается, одним из вариантов адаптивного ответа на недостаток белка было возникновение различных форм каннибализма. «Умеренный» каннибализм, по оценкам исследователей, мог обеспечивать, например, некоторым группам обитателей нагорий Новой Гвинеи годовое поступление примерно 10% необходимого им животного белка.

Известный историк экономических учений Ангус Мэддисон так объясняет произошедшую за исторически мгновенный срок метаморфозу: «Исследовательский аспект в экспериментальной науке имел для Запада исключительное значение и стал главным условием ускорения технического прогресса, проявившего себя в полную силу в XIX–XX вв.».

Вот лишь краткая сводка экспериментальной активности Запада, позволившей ему в итоге так рвануть вперед в деле обеспечения хлебом насущным (Источники: Ю.Н.Елдышев. «Современные биотехнологии», 2004; А.И.Козлов. «Пища людей», 2005):

1590 – изобретение микроскопа;
1675 – открытие бактерий (А.Левенгук);
1857 – открытие бактериальной природы брожения (Л.Пастер);
1865 – открытие законов наследственности (Г.Мендель);
1870–1890 – получены первые гибриды кукурузы и хлопчатника, обладающие новыми свойствами; первые удобрения;
1909 – открытие одного из наиболее важных процессов промышленной химии – синтез аммиака под высоким давлением (Ф.Габер, Германия). Не менее 40% из 6 млрд. населения Земли живы лишь благодаря открытию синтеза аммиака. Сегодня в мире ежегодно потребляется свыше 80 млн. т азотных удобрений. Внести такое количество азота в почву с помощью органических удобрений было бы совершенно немыслимо, даже если бы все мы только этим и занимались;
1933 – получены первые гибриды кукурузы, предназначенные для коммерческого использования (США);
1948 – основополагающие работы в области изучения химических средств защиты растений от вредителей, и в первую очередь – обнаружение поразительных инсектицидных свойств ДДТ (П.Г.Мюллер, Швейцария);
1950-е – переход от традиционного выпаса домашних животных на технологии стойлового разведения. В результате за 50 лет (к 2002 году) мировое производство мяса выросло в 5 раз, в пересчете на душу населения – более чем вдвое. Кстати, для производства каждого килограмма говядины требуется около 7 кг зерна, свинины – 4 кг, птицы и прудовой рыбы – примерно 2 кг;
1953 – расшифрована структура ДНК (Дж.Уотсон, Фр.Крик);
1963 – получены новые сорта пшеницы, увеличивающие урожайность на 70% (Н.Борлоуг); начало «зеленой революции» в сельском хозяйстве;
1990 – первый зарегистрированный продукт питания с генетически модифицированными ингредиентами: ГМ-дрожжи (Великобритания);
1996–1997 – начало возделывания первых ГМ-культур: кукуруза, соя, хлопчатник (Австралия, Аргентина, Канада, Китай, Мексика, США).
А теперь сопоставьте с этими данными такой факт: признанная в мире эталоном французская профессиональная кухня начала формироваться как раз только в XVII веке, в эпоху правления Людовика XIV. При королевском дворе состояло более 300 поваров. Даже прообраз современного ресторана впервые появился во Франции лишь около 1765 года. Но уже в 1840 году в Париже их насчитывалось более 500.
Как это ни парадоксально, но открытие месторождений нефти и стремительное совершенствование технологий ее переработки тоже внесли свой вклад в сытое настоящее современной западной цивилизации. Андрей Козлов, например, отмечает, что «до распространения нефтепродуктов и электричества, то есть практически до последней трети XIX века, в европейских хозяйствах животные жиры рассматривались прежде всего как сырье для получения источников света: свечей и масла для ламп. Присутствие на столе очень дорогой жирной пищи служило в первую очередь показателем достатка хозяина и демонстрацией его высокого социального ранга».

http://www.ng.ru/science/2007-02-14/11_techs.html


Мне приходилось решать задачи этим физтеховцам
- Tuesday, February 27, 2007 at 04:23:53 (PST)

Я МГУ заканчивал - один из естественных факультетов, и не физфак, но математику и статистику там изучали - в универе вообще принято своим студентам широкое образование давать:-)
A потом стал второе высшее получать в другом вузе. Так вот со мной в группе училось почему то (?!) достаточно много физтеховцев.
И во втором вузе изучали мы всякие статистики и эконометрики на достаточно серьезном уровне.
И вот некий парадокс - почему то мне эти абсолютно чуждые предметы давались заметно проще, чем этим хваленным зубрам математики:-)
По крайней мере я и сдавал экзамены лучше, а часть из них из пересдач не вылезали, но ГЛАВНОЕ - что я им для семинаров задачи решал, а не они мне, что явно было бы логичнее.
При этом я явно не математический гений, просто меня в универе приучили к системности мышления и умению решать нестандартные задачи. Но ладно, Бог с ней, с эконометрикой, в повседневной работе она может не всем и нужна.
Но вторая серьезная проблема физтеха - абсолютное неумение грамотно излагать свои мысли, особенно в письменном виде! Ну про грамотность говорить даже не стоит, хотя ТАК писать на родном языке все-таки стыдно.
Но при этом они же просто не могут выстроить свой текст так, чтобы можно было понять - а что автор хотел сказать то? Пришлось мне диплом одного из них проверять -по дружбе, так эти фразы на абзац любого человека доведут:-) А цимес то весь в том, что многие планировали аналитической работой заниматься, но какой же это аналитик, который не умеет обобщать факты, делать из них логичные выводы и к тому же изложить свои мысли понятным для остальных образом????
Зато самомнения хватало:-)
И жизнь подтвердила - стали они в основном всякими менеджерами (или скорее манагерами) по продажам и т.п.
А я в консалтинг подался и консультирую теперь даже не их, а владельцев их фирм:-) Ну и как отличается наш нынешний личный доход даже говорить не хочется:-))) Может, это и есть те самые успехи в бизнесе?

В общем, МГУ for ever!
http://www.gazeta.ru/education/2007/02/22_e_1403421.shtml


Недостатки физтеховцев: самоуверенность и слабая математика
- Tuesday, February 27, 2007 at 04:21:43 (PST)

Как ни странно, к недостаткам можно отнести плохое знание математики. Похоже, они доносят до конца третьего курса все это как жонглер пирамиду на голове, а потом все это просто выбрасывают.
То есть, помнить-то они помнят, но как этим пользоваться не знают совершенно. Например, просишь найти простое приблизительное решение для анализа на пальцах, а тебе приносят нечто, выраженное в специальных функциях, которые неизвестно где табулированы. И ко всем попыткам добиться чего-то еще относятся презрительно.

http://www.gazeta.ru/education/2007/01/24_e_1292289.shtml




70 лет спустя вновь появилась женщина-раввин
- Tuesday, February 27, 2007 at 03:29:16 (PST)

Еврейское время определяется двумя способами, имеет два измерения мира. Одно – циклическое, которое за год возвращается в исходную точку. Второе – время, имеющее форму линии, конец которой нам не дано представить, его следует терпеливо ждать. Первое время – время стабильности и традиции, второе – неуверенности и новизны. История большой синагоги на Ораниенбургерштрассе в Берлине, с ее яркими куполами в мавританском стиле и мощными нефами, представляет собой чудесное сочетание двух измерений еврейского времени, кругового времени истории, которое повторяется, и линейного, времени будущего, всегда отличающегося от того, что было. История разворачивается в этих торжественных стенах, ставших живым воплощением Освобождения, которое пережили евреи Европы, а также способом выразить свою благодарность, подарив городам монументальные и величественные храмы, как этот. Но история Регины и Гезы не слишком величественная. Это история женщин, и она довольно простая. Она почти диссонирует с таким внушительным зданием.
В синагоге на Ораниенбургерштрассе 70 лет назад служила первая в мире женщина-раввин. Ее звали Регина Йонас, она отличалась некоторой застенчивостью и непомерной тягой к знаниям. В 1935 году она получила свидетельство о рукоположении в сан. Она была очень активным раввином, как в культурном, общественном плане, так и в том, что касалось богослужений. Так было до 1942 года, когда она была депортирована в Терезиенштадт. Но ее следы не сразу затерялись: в этом гетто-тюрьме она работала как seelsorger, "врачевательница душ", вместе с психиатром Виктором Франклем. Но оттуда она не вернулась. 70 лет по еврейском нумерологии, мера времени, которую трудно определить. Спустя 70 лет 38-летняя Геза С. Эдербергер стала новой женщиной-раввином в синагоге на Ораниенбургерштрассе в Берлине. Геза – мать двух 6-летних близнецов. Она изучала физику в университете в Тюбингене и приняла иудаизм около 15 лет назад: она родилась в немецкой протестантской семье. Она изучала иудаизм в Иерусалиме и получила профессию раввина. Ее возвращение в Германию наполнено многогранным смыслом и соответствует двум мерам еврейского времени.

История повторяется через смелый и сильный поступок: и Регина, и Геза пошли против истории. Первая открыла дорогу для поистине новой роли для женщины в еврейской литургии. Вторая – избрав эту дорогу, но и преодолев историю последних 70 лет, со всем тем, что имело значение для этой точки мира. Через этих женщин история бросает вызов самой себе и подтверждает то, что невозможно задумать будущее и не быть готовыми к смене карт на столе. Даже перевернуть их. Как поступила Регина, решив не стоять в стороне и поставив перед собой амбициозную цель, которая до того времени казалась недостижимой: быть раввином, но оставаться женщиной. Как поступила в эти последние годы Геза, пойдя по стопам Регины, чтобы построить здесь, в синагоге на Ораниенбургер, новое будущее.

Мораль этой истории нетрудно отыскать. Лишь благодаря деликатному, но возможному равновесию между традицией и обновлением, между повторением и желанием изобретать, религия находит дорогу в будущее. Совсем как Руфь из Библии, ставшая матерью прародителя царя Давида. Но история никогда не повторяется, и Гезе, новой женщине-раввину Германии, предстоит строить собственное будущее.

Родившаяся в 1902 году в Берлине, Регина Йонас была посвящена в раввины в 1935 году после длительной борьбы. Она стала первой в мире женщиной, добившейся права совершать богослужения по канонам иудаизма. Вместе со своей общиной она пережила все невзгоды немецких евреев, в 1942 году была депортирована в лагерь Терезиенштадт, где продолжала проповедовать и учиться, оказывать психологическую помощь другим заключенным. В 1944 году женщина-раввин была переведена в Освенцим, где и умерла.
http://www.inopressa.ru/lastampa/2007/02/13/15:49:59/rabbina


К размышлению.
- Tuesday, February 27, 2007 at 03:02:21 (PST)

Роботов учат воспринимать эмоции
- Monday, February 26, 2007 at 11:39:00 (PST)
На днях стали известны детали научно-исследовательского проекта Feelix Growing, объединившего 6 стран и более 25 квалифицированных специалистов по робототехнике, физиологии и неврологии. Главная цель ученых - научить неживых роботов взаимодействовать с человеком на эмоциональном уровне. Координатор проекта Лола Канамеро (Lola Canamero) сказала, что их задача – переступить ту «неживую» грань, которую не могут перейти роботы, поднять уровень общения и взаимодействия между человеком и машиной в социальном и эмоциональном аспекте....

>>>>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<<<<<<<<<

........Но надо было видеть и К.Л.!.. Не всякому дано быть тамадой на собственной свадьбе. Он сорил анекдотами; он обучал местную научную элиту жарить мясо по-техасски; организовал пятиминутный теоретический семинар по плетению лаптей; пил на брудершафт...
Он, только он, был подлинным героем дня. Это в него стремительно и наглядно, как в односерийном американском боевике, влюблялась роскошная аспирантка из Ростова, прибывшая только что со своими грузинскими друзьями на "Волге" цвета морской пены...

Гл. XXXVП.
Я КАК-ТО УЖЕ ВИДЕЛ ЕЕ В МОСКВЕ, присутствовал на ее защите. Тема диссертации была самая боевая, хватала за душу:"Моделирование чувственных представлений". Вопрос ставился в лоб: способен ли компьютер испытывать
сексуальную потребность (при соответствующем программном обеспечении)
, - и народу набилась уйма.
Помнится, защита прошла прекрасно. Не только потому, что аспирантка, в самом деле, представляля собой нечто особенное, но и потому, что всем все было понятно, даже членам аттестационной комиссии. Математики было совсем мало, минимум, зато максимум искренности, темперамента, взволнованных модуляций голоса, трогательных, прямо-таки беззащитных улыбок в разгоряченный, переполненный мужчинами зал. Казалось, весь цвет отечественной кибернетики собрался там, а вентиляция не работала...

М. Тартаковский. Герой НАШЕГО времени. Роман.
pereplet.ru



Серьезные баталии на форуме
- Tuesday, February 27, 2007 at 02:55:27 (PST)

"Пушкин в ермолке" Анатолий Штаркман vs Григорий Фридман

http://berkovich-zametki.com/Forum/viewtopic.php?t=1188&start=15&sid=0077203a3337405122d3b67e465d903c


Матроскин
- Tuesday, February 27, 2007 at 02:35:11 (PST)

Бер
- Monday, February 26, 2007 at 15:26:32 (PST)
Многоуважаемому АК
и остальным участникам обсуждения времени Исхода.

Вместо указания конкретной цифры и ее четкого обоснования (в виде отсылки к великим комментаторам) обсуждение данной темы оказалось заполненным то открытиями америк (например, Санторина), то какими-то размышлизмами о физиологически возможных возрастах произведения на свет потомства… и всей тому подобной галиматьей, а так же цитированием каких-то посторонних авторов, придумывающих вообще черт-те-что. В то время, когда есть выверенная многими веками, внутренне непротиворечивая и широко опубликованная хронология. Которую вообще, оказывается, никто не знает и знать не хочет.
И это - евреи ? я вас спрашиваю…
+ + + + + + + + + +

Господин Бер,

ВНЕ ЗАВИСИМОСТИ ОТ ПРЕДЫДУЩИХ РАЗНОГЛАСИЙ!

Люди делятся на две категории: а) теряющих пульс от одного соприкосновения со священным текстом, и б) относящихся к тексту с уваженем но без трепета.

Категория «а» ищет высший скрытый смысл в непонятном, и для этого измеряет высоту букв, расстояние между ними и даже цвет чернил.

Категория «б» видит фантастические привнесения в текст и внутренние противоречия документа, и пытается найти им разумное объяснение.

Вы относитесь к категории «а», я отношусь к другой, и этого не скрываю.

Прийти к выводу о том, что 10 казней египетских – последствия извержения вулкана не представляет никакого труда. НО, с 1200 по 1600 год до н.э. произошло несколько ТЫСЯЧ извержений вулканов в разных частях света. Только в 1300 году до н.э. произошли следующие относительно крупные извержения:
Avachinsky Russia 1300 BC
Fuji Japan 1300 BC ± 150 years
Taveuni Fiji 1300 BC
Vulcano Italy 1300 BC
Mauna Loa United States 1300 BC
Cayambe Ecuador 1300 BC

Скажите, какое из них, по Вашему мнению, могло бы привести к катастрофическим последствиям для окружающей среды в Египте? Если Вы относитесь к категории «генералиссимусов», то Вам сделать это будет просто и легко. В противном случае придется перелопатить гору литературы по вулканологии – до этого момента совершенно неизвестной для Вас области, а потом уже обоснованно прийти к выводу. Или же, если Вы относитесь к категории «а», то можете априори объявить все это чушью, и громко об этом заявить. Что, собственно, Вы и делаете. Но, тогда не обижайтесь, что к Вашим доводам будут относиться подобным же образом.

А кого лично Вы считаете или не считаете евреем, лично меня совершенно не волнует.

Здоровья и удачи!



Элла
- Tuesday, February 27, 2007 at 01:53:09 (PST)

В момент перестройки у меня появилось ощущение, что я представитель третьего мира.

Ощущение было верным, впоследствии подтверждено, в частности, г-ном Путиным ("энергетическая держава").


Евгений Беркович
- Tuesday, February 27, 2007 at 01:24:58 (PST)

Хочу добавить пару замечаний к интересному обмену мнениями об Испании и Италии.

Игрек
- Monday, February 26, 2007 at 14:29:58 (PST)
"Глубокий системный беспорядок" - очень точное замечание. Исторически, так в средне- и послесредневековой Италии было всегда. Прелесть к чему привела их политическая неустроенность и постоянная вражда-дружба друг с другом, буквально одной горки-города с другой (это совершенно наглядно видно именно в Умбрии). Как ни странно, или это как раз и не странно, в сегодняшней действительности такой системный беспорядок оказался предпочтительнее плодов системного полицейского государства, Испании.


Вот цитата из заметки "Банальность добра" (http://berkovich-zametki.com/AStarina/Nomer2/Ital2.htm):

Стоит вспомнить, что добродетель часто произрастает из недостатков, а преступление -- из доведенных до абсолюта достоинств. Пруссия добилась того, что удавалось очень немногим: здесь практически полностью была искоренена коррупция на государственной службе. Прусские чиновники служили государству как божеству, но за параграфами инструкций и циркуляров исчезал живой человек.
Для итальянской бюрократии, напротив, характерны необязательность и расхлябанность, так раздражавшие немцев. Мафия и коррупция, карбонарии, масоны и иезуиты -- вот типичный «коктейль» итальянского общества. Но продажность чиновников помогала спасать евреев: за деньги можно было купить свободу и жизнь, а богатая традиция заговоров помогала долгое время игнорировать приказы дуче.
Ханне Арендт принадлежит термин "банальность зла", которым она определила точные, пунктуальные ответы Адольфа Эйхмана на процессе в Иерусалиме.
То, что двигало итальянцами в отношении евреев в годы фашизма, можно было бы назвать "банальностью добра". В душах многих людей сохранился определенный порог порядочности, перейти который они не могли даже по приказу дуче. Престиж нации, совесть и человечность оказались не пустыми словами для многих итальянцев -- от простых солдат до генералов и министров.


И еще одно личное наблюдение во время одной непростой поездки в Венецию (http://www.berkovich-zametki.com/Venedig.htm):

В Венеции так много "породистых", красивых лиц, что даже морды собак кажутся особенно выразительными.




Игрек
- Tuesday, February 27, 2007 at 00:49:39 (PST)

Виктор-Аврум оказался пророком. На Чейни было совершено покушение. В Афганистане (ошибка простительна). Чейни не пострадал, 19 человек убито.
Виктор-А, что дальше по сценарию?


Музыка сфер
- Monday, February 26, 2007 at 23:46:15 (PST)

Дерьмометр

Все было пасмурно и серо,
И лес стоял, как неживой,
И только гиря говномера
Слегка качала головой.

Не все напрасно в этом мире,
(Хотя и грош ему цена),
Покуда существуют гири
И виден уровень говна!

Александр Галич


Юрий Башмет, альтист

- В момент перестройки у меня появилось ощущение, что я представитель третьего мира. Контакты держались на чисто профессиональном уважении. И только в последние годы стали хоть как-то считаться с нами. Все, что происходит и все, что мы чувствуем изнутри, выразил в Мюнхенской речи наш президент.

- У вас есть музыкальные ассоциации на выступление президента?

- Концерт Шнитке для альта. Потому что там все на сто процентов так, как я ощущаю. Я не политик, но у меня был абсолютный восторг. Это сила драматизма, смелость, яркость - все напоминает мне Шнитке.
http://www.grani.ru/blog/govnomer/


Александр Солженицын - о событиях, которые трагически изменили не только судьбу России, но и ход всемирной истории
- Monday, February 26, 2007 at 23:27:28 (PST)

У нас называют три революции: 1905 года, Февраля 1917 и Октября. Но в 1905-06 не произошло существенных перемен государственной и народной жизни, и не было движения миллионных масс: была симуляция революции, было много разрозненного террора (и уголовного), когда революционеры (и уголовники) и интеллигенты - толкали, толкали, раскачивали, раскачивали - а оно никак не раскачивалось и не раскачалось. А Февраль - даже неправдоподобен: дремота страны, ничтожное участие масс - и никакого сопротивления власти. А Октябрь - короткий грубый местный военный переворот по плану, какая уж там революция?

Ни одна как будто - не подходит под революцию. Две последних - весьма точно назвать переворотами.

Но несомненно, что в XX веке в России произошла величайшая кровавая необратимая революция всемирового значения. Необратимостью и радикальностью перемен только и определяется революция.

Если в Феврале было мало крови и насилия и массы ещё не раскатились, - то всё это ждало впереди: и вся кровь, и всё насилие, и захват народных масс, и сотрясение народной жизни. Революции бывают и медленные - но, начавшись, уже неуклонны, и насилие в них потом всё разыгрывается. Наша революция разгуливалась от месяца к месяцу Семнадцатого года - вполне уже стихийно, и потом Гражданской войной, и миллионным же чекистским террором, и вполне стихийными крестьянскими восстаниями, и искусственными большевицкими голодами по 30, по 40 губерний - и может быть закончилась лишь искоренением крестьянства в 1930-1932 и перетряхом всего уклада в первой пятилетке. Так вот и катилась революция - 15 лет.

Российская революция закончилась в начале 30-х годов. И тотчас была почтительно признана китом западной демократии - Соединёнными Штатами.

http://www.rg.ru/2007/02/27/solzhenicyn.html


Борис Михайлович
- Monday, February 26, 2007 at 22:55:39 (PST)

В письменной вроде не говориться о краже краже людей.
*******
Говориться.


Дмитрия Сергеевича нет сейчас с нами, но слог его живет: нет мягкого знака в глаголах, отвечающих на вопрос "что делают?", "что делает?". Иначе чистая русофобия, правильно тут товарищ предупреждал.


Ontario14
- Monday, February 26, 2007 at 21:01:28 (PST)

Виктор Б
- Monday, February 26, 2007 at 15:36:53 (PST)
Вопрос не ради судебной практики, а истины для. "Другой пример из "10-и заповедей" - "не укради". Только люди, знакомые с Устной Торой знают, что здесь речь идет о
краже (по русски - похищении) людей и наказании за это смертной казнью --- сколько требуется знатоков устной Торы, чтобы подтвердить это положение? В письменной вроде не говориться о краже краже людей.

*******
Говориться. "Шмот" (21,16) Недельная глава "Мишпатим"(позапрошлая)


Ontario14
- Monday, February 26, 2007 at 18:53:21 (PST)

Gena
- Monday, February 26, 2007 at 08:56:54 (PST)


********

Дорогой Гена, Вы читаете мои ответы?
Ну хорошо, попробую ещё раз.
Вы и ваш раввин излагаете точку зрения Хазон-Иша, согласно которой (с опорой на вашу цитату из Иерусалимского Талмуда) "всё, что ВОССТАНОВЛЕНО в Талмудах - уже было раз дано Всевышним на Синае".

Есть другое мнение. Его высказал РАМБАМ (тоже с опорой на цитаты) - Моше получил на Синае ПРИНЦИПЫ(клалим), а не только Законы.
וכי כל התורה למד משה, כתיב בתורה: 'ארוכה מארץ מדה ורחבה מני ים', ולארבעים יום למדה משה? אלא, כללים למדהו הקב"ה למשה.
"И всю Тору изучал Моше, как сказано в Торе:"Длиннее Земли и шире моря", а что 40 дней учил Моше? Принципы(клалим) давал ОН Моше" (сорри за импровизированный перевод)
(Мидраш Танхума ט"ז)

Кстати, приведённое мной ранее разделение Устной Торы на 3 части("дано - не дано") - это тоже из РАМБАМа("Мишне-Тора")

Подробнее об этих противоречиях:
http://www.birkatmoshe.org.il/images/hbcag01.doc (статья на иврите, - по-русски не нашел)




Ontario14
- Monday, February 26, 2007 at 18:50:46 (PST)

АЕД
- Monday, February 26, 2007 at 08:16:07 (PST)
Мы делали по-другому: просто «не понимали», когда дети начинали с нами говорить по-английски.

********
Поразительно! И мы !



Ontario14 - Буквоедy
- Monday, February 26, 2007 at 18:49:46 (PST)

Буквоед - Ontario14
- Monday, February 26, 2007 at 06:48:37 (PST)

********
Умэйн !



Ontario14
- Monday, February 26, 2007 at 18:49:10 (PST)

AK
Boston, MA - Monday, February 26, 2007 at 06:02:40 (PST)
...входили ли эти "разноплеменные" в число переписи...

**********
Несомненно.



AK
Boston, MA - Monday, February 26, 2007 at 17:37:28 (PST)

>Бер, Monday, February 26, 2007 at 15:26:32 (PST)
#################

Уважаемый Бер,

Благодарю за изложение четкой позиции по Торе. Основные дискуссии, которые я здесь инициировал, а стало быть, и с меня спрос, ставили задачей (для меня) узнать времена рождения сыновей Иакова. В смысле, период - с такого-то года по такой-то, в обратном отсчете от нашего времени. У меня сложилось впечатление, что Вы такой ответ можете дать. Был бы признателен.

Что касается остальных Ваших замечаний - не вправе их комментировать. Кроме того, что из Ваших комментариев узнал для себя немало нового. К сожалению, по основному моему вопросу узнал только то, что время пребывания в Египте было 210 лет со времени прихода туда Иакова с расширенным семейством (хотя этот срок здесь ранее уже упоминался). А поскольку Иаков пришел туда 130-летним человеком, то родился он за 340 лет до Исхода. Но на мой исходный вопрос это так и не отвечает.

...поскольку одна его позиция показалась мне неясной.
>К Библии я отношусь бережно, хотя прекрасно понимаю всю условность точной там датировки. Это все могло быть типа Lost in Translation через тысячи лет, и мы просто обсуждаем перевод из фаренгейтов в реомюры, не имея в руках калькулятора, да и формулы перевода тоже.
>Мне неясна сопряженность «бережного отношения» к Библии и постулирования «условности» ее датировок. Мне, почему-то кажется необходимым условием честного исследования – четкий выбор или той или другой позиции. ... Я не прав?


Ну как Вам сказать? Скорее нет, чем да. Это - на последний вопрос. Потому что Вы, как это часто бывает с запальчивыми дискутантами (извините, но я без экивоков), не подумали о смысле слова "бережно", а именно о том, что у него могут быть множественные интерпретации. И как запальчивый дискутант Вы выбрали свою собственную интерпретацию, одну из многих, и фактически обвинили в отсутствии честной позиции, или четкой позиции. То есть запальчивость проявляется и в том, что при множественных вариантах выбора смысла слова "бережно" выбирается именно аккузативный вариант, хотя есть гораздо более позитивные и доброжелательные варианты.

Теперь я поясню, что такое "бережно" в данном контексте и в моем варианте. Это то, что я не пытаюсь критиковать Библию, не пытаюсь найти там слабины, хотя у меня в руках есть современный научный инструмент - ДНК-генеалогия. И когда у меня не стыкуется, я не говорю - в Библии неверно. Я говорю - мои познания слабы, и когда я не понимаю, это не потому, что там неверно, а потому, что я не так перевожу ее содержание и смысл. Поэтому я пытаюсь адаптировать мои современные познания к Библии, а не наоборот.

Вот что такое бережно, в моем понимании.

И в этом я вижу честность и четкость моей позиции. В отличие от того, что увидели Вы.

Вообще говоря, я считаю, что есть качество дискутанта (в широком смысле), которое трудно переоценить. Это способность увидеть в словах собеседника не то, что хочется увидеть, и тут же перевести в аккузативную плоскость, а то, что хотел сказать собеседник. Вот это то, что нам часто не хватает.




Б.Тененбаум - Инне
- Monday, February 26, 2007 at 16:26:06 (PST)

Молодой человек, родившийся в США, самонадеянно заявил отцу, что его следует считать bilingual. Ему мягко было сказано его мамой, что он не знает, как спросить по-русски время на улице. Самонадеянный молодой человек решил поднять планку, и спросил -
"Спросить время вежливо или невежливо ?".
"Ну, пусть невежливо" - уточнила задачу мама.

Юноша подумал и сказал: "Давай часы !" :)

Историю эту я знаю из первых рук, так как она произошла с нашим младшим сыном :)


Игрек
- Monday, February 26, 2007 at 16:09:27 (PST)

Беру

Перечитаю главку из книги Джонсона и постараюсь Вам ответить детально. Или сегодня или завтра.


Inna
- Monday, February 26, 2007 at 16:05:27 (PST)

Б.Тененбауму
Я такие перлы выслушиваю почти ежедневно и время от времени порываюсь их собирать. Вот некоторые: Дочь была на имерженсах. Увезли на джонку. Никаких скрячей. Получить мой соушан.
А эти вроде бы без «английских» вкраплений, но тоже свидетельствуют об уровне владения родным языком:
(О споре) Я не знаю, какой компромисс пошел между ними.
Я не знаю юга. Юг - это назад идти?
(О погоде) Очень нормальная, хорошая.
Меня вообще зовут Лариса.
Пожелтение глаз... Это печень заинтересована в этом.


Бер
- Monday, February 26, 2007 at 15:45:16 (PST)

Игрек
- Sunday, February 25, 2007 at 23:14:21 (PST)

……. в книге Paul Johnson "A History of the Jews", книге весьма тщательно и аргументировано написаной, сказано, что "исход произошел в 13 столетии и был закончен около 1225 года". Там же сказано, что не все братья (колена) ушли в Египет (теория весьма известная). Несколько братьев (колен, конечно), от 4 до 6, провели все время "египетского пленения" в землях хаананских.

======================

Я не знаю религиозной принадлежности приводимого Вами автора, а так же заданности его какой-то целью, и его же научной пунктуальности. А неплохо бы и уточнить все это – т.е. каково обоснование Вашему утверждению о том, что его работа «тщательно и аргументировано написана». Тем более, что к тому же Вы утверждаете, что сие есть «теория весьма известная». У меня на этот счет очень крупные сомнения – не по «известности» (мало ли чего есть известного «всем» – например, что евреи пьют кровь младенцев), а по фактологии.
Итак, на чем базируется цитированное Вами утверждение? Вопрос обоснованный, ибо в Торе такого просто нет. Более того, в Торе - масса эпизодов, прямо утверждающих присутствие всех колен (12 или 13 – счет может быть по разным основаниям) – и при Исходе, и под Синаем, и в пустынных странствиях.
Ну, скажем, навскид:
1. двенадцать тоннелей через расступившиеся воды моря Суф – по тоннелю на колено (правда, это не сама Тора, а комментарий к ней – соответствующий мидраш; ну да ладно, дальше строго по Торе)
2. Двенадцать разведчиков в Землю Обетованную – по одному от колена. Приводятся все имена и принадлежность к колену.
3. Перечисление приношений в Храм – опять же поименованы все колена и их главы на тот момент.
4. При исчислении всех евреев указывается численность буквально каждого колена, имеющегося тут – в наличии.
5. Расположение еврейских колонн (по коленам) при передвижении по пустыне, при форсировании Иордана и проч. - ни одно колено не выпадает!

И т.д., и т.п. – примеры можно множить и множить. При востребованности дам точные ссылки.
Так как же комментирует (опровергает) все это тот самый Paul Johnson? – не еврей, судя по всему. И какие-то еще другие авторы?? Или у них появились свои данные, независимые от Торы?
Неужто в Синайской пустыне раскопали остатки шести колен, а остальных обнаружили в Кнаане – и в строго синхронизированных пластах??? Сенсация будет, однако же! «Библейская критика» спит и видит - ну хоть что-нибудь подобное…



Виктор Б
- Monday, February 26, 2007 at 15:36:53 (PST)

Вопрос не ради судебной практики, а истины для. "Другой пример из "10-и заповедей" - "не укради". Только люди, знакомые с Устной Торой знают, что здесь речь идет о
краже (по русски - похищении) людей и наказании за это смертной казнью --- сколько требуется знатоков устной Торы, чтобы подтвердить это положение? В письменной вроде не говориться о краже краже людей.


Бер
- Monday, February 26, 2007 at 15:26:32 (PST)

Многоуважаемому АК
и остальным участникам обсуждения времени Исхода.

Начну с цитат.
1. – открывшая дискуссию.
[i]AK
Boston, MA - Friday, February 23, 2007 at 06:20:26 (PST)
Уважаемые братья по разуму….у меня вопрос к знатокам еврейской истории и старины.
………………..
Однако всё путают 430 лет в Египте ……..То есть в Египте всего должно пройти лет 130. ………Как трактуется это очевидное расхождение с 430 годами в Египте? Как считать?
[/i]

2. – одна из последних.
[i]AK
Boston, MA - Monday, February 26, 2007 at 03:47:10 (PST)
……. Если Исход был в 1225 ("около"), то они провели в Египте 297 лет.
[/i]
===========================

Видите ли, уважаемый профессор, для евреев, мало-мальски изучающих Тору в этих Ваших недоуменных разночтениях нет никакого вопроса, никакой проблемы. Как и вообще в хронологии всех библейских эпизодов. Она (хронология) разработана доскональнейшим образом еще тысячелетиЯ назад.
Подчеркиваю: РАЗРАБОТАНА, а не вымышлена, не высосана из пальца, ибо все необходимые сведения заложены в Торе изначально.
Тора – в отличие от многочисленных других мировоззренческих построений – не миф, а ТОЧНО ЗАДОКУМЕНТИРОВАННАЯ ИСТОРИЯ. Иной она и не может быть, т.к. открыто претендует на функцию весьма конкретного конспекта-плана сотворения мира. В ней приведены ясные и однозначные цифры лет отцов при рождении их первенцев (а где надо – и не только первенцев, а вдобавок и сынов-не-первенцев, если таковые являются важнейшими узлами родословия евреев) – буквально всех, начиная от Адама. Именно благодаря этому еврейскими мудрецами просчитана точная хронология по всей нашей истории.
Я, правда, не больно вникаю в детали точной хронологии – она вне сферы моих собственных интересов. И я не прослеживал, соответственно, всех перепитий данной дискуссии здесь. Меня как-то больше интересуют качественные характеристики, нежели количественные.
Но, коли уж есть кому-то в том надобность, то в Торе датировки абсолютно однозначны. Как пример: давным-давно по Торе высчитано время сотворения мира – и сейчас на еврейском календаре 5767-й год от этого момента. И это – согласно Торе – «медицинский факт». Чего никак нельзя сказать о 2007-м годе от р.х., даже если считать само рождение Христа медицинским фактом.
Такими же абсолютными фактами являются и датировки всех прочих внутриеврейских эпизодов. И кажущиеся несоответствия – типа разночтений во времени пребывания в Египте – наши мудрецы давным-давно разрешили.

В Египте евреи провели 210 лет и были выведены досрочно, т.к. из-за общения с египтянами и в стремлении стать от них малоотличимыми, потомки Иакова (будущий еврейский народ) упали до предпоследнего уровня нечистоты – 49-го. Еще годик (а может и месяц!) и выводить было б некого – по всему Мицраиму (Египту) была б совершенно однородная масса идолопоклонников.
Но и цифра 400 лет как бы осталась в действии – столько годов прошло, если считать их не от спуска Иакова с сыновьями в Мицраим, а от получения Авраамом соответствующего Б-жественного известия об этом.
Обо всем этом узнать - ну совершенно нетрудно. Надо просто заглянуть в комментарии к Торе – прямо по тому пункту, что указан профессором – Исход, 12:40. (по Торе это, соответственно, Шмот, 12:40)
Ну, например, по ссылке http://www.machanaim.org/tanach/b-shemot/indb03_2.htm
Процитирую оттуда комментарий Сончино - один из трех там имеющихся вариантов комментариев.
----------------------
[i](Шмот, 12)
40. ЧЕТЫРЕСТА ТРИДЦАТЬ ЛЕТ. При заключении союза Всевышнего с Авраhамом праотцу еврейского народа было предсказано, что его потомство четыреста лет будет находиться в изгнании, в рабстве. Мидраш говорит, что Всевышний, по милости Своей, начинает отсчет этих четырехсот лет, как только у Авраhама появляется потомство, т. е. со дня рождения Ицхака. Заключение союза состоялось, когда Авраhаму было семьдесят лет. Ицхак же родился, когда Авраhаму было сто лет. Нетрудно заметить, что 430 лет, указанные здесь, отсчитываются не от момента рождения Ицхака, а от момента заключения союза с Авраhамом. Мидраш рассказывает, что приведенное в данном месте текста число лет намекает на ошибку, которую за тридцать лет до исхода совершило колено Эфраима. Многие из сынов этого многочисленного колена решили, что исход из Египта должен состояться по истечении четырехсот лет после заключения союза с Авраhамом. Они также решили, что исход должен состояться независимо от того, получит еврейский народ непосредственное повеление свыше или нет. Поэтому часть колена Эфраима за тридцать лет до описываемых событий, вооружившись, прорвалась за охраняемые границы Египта. Все они погибли, так как были лишены той защиты свыше, которую дал Всевышний евреям в момент исхода. Филистимляне, узнавшие о том, что колено Эфраима пересекло границы Египта и направляется в сторону Кнаана, чтобы завоевать его, вышли им навстречу и уничтожили всех тех, кому удалось вырваться из египетского рабства. НЕСЛОЖНЫЙ ПОДСЧЕТ ПОКАЗЫВАЕТ, ЧТО ЕВРЕИ НАХОДИЛИСЬ В ЕГИПТЕ 210 ЛЕТ: С МОМЕНТА ПРИХОДА ТУДА СЕМЬИ ЯАКОВА ДО ИСХОДА. [/i]
(Выделено регистром мною. Б.)
-------------------------------
Может быть, кому-то интересно будет узнать, что и трагические эпизоды у евреев всегда несут полезное зерно для дальнейшей их истории. Вот и здесь из многих тысяч героических сынов Эфраима, полегших при этой неудачной попытке завоевать Эрец Исраэль, отбились от филистимлян и вернулись назад только десятеро. Но зато один из этих десяти был Йегошуа бен Нун (в христианском прочтении – Иисус Навин), получивший здесь хорошую закалку и опыт, и через семьдесят лет (30+40) поведший новое поколение евреев на завоевание этой же Страны Обетованной. Он же – полезно отметить - был одним из двух разведчиков (из 12-ти в общем числе), не испугавшихся филистимлян при первой разведке сразу после Синайского откровения, и звавших евреев не поддаваться панике, а завоевывать Землю Израиля сразу же – сходу. (Увы, морально задавили тогда 10 трусов).

Ну, ладно. Вернусь к теме.
Во всей этой дискуссии несколько удивили меня именно евреи. Профессору можно только честь отдать – за его интерес к нашей истории и разработку данного вопроса.
А вот к остальным (ужо прошу прощения за все возможные обиды) у меня есть претензии.
Где-то с полгода назад я выставлял здесь адреса разных переводов Торы и комментариев к ней. Очевидно, они не заинтересовали никого – никто не смог дать профессору нужную точную справку (включая того самого писателя, к кому адресовалось конкретно то мое послание с соответствующими адресами, который и тут, между прочим, бравирует своими эпохальными библио-размышлениями).
Вместо указания конкретной цифры и ее четкого обоснования (в виде отсылки к великим комментаторам) обсуждение данной темы оказалось заполненным то открытиями америк (например, Санторина), то какими-то размышлизмами о физиологически возможных возрастах произведения на свет потомства… и всей тому подобной галиматьей, а так же цитированием каких-то посторонних авторов, придумывающих вообще черт-те-что. В то время, когда есть выверенная многими веками, внутренне непротиворечивая и широко опубликованная хронология. Которую вообще, оказывается, никто не знает и знать не хочет.
И это - евреи ? я вас спрашиваю…

Ну-с, так. Сдублирую, все же, здесь мои прошлые ссылки на Тору и комментарии к ней в сети, на сей раз без разжевывания – по какой ссылке какие переводы (а они разные) и какие там комментарии (Ежели вдруг-таки кому-то окажутся нужными более детальные разъяснения – покопайтесь в архиве, помнится, в первых днях сентября).
Сайт «Маханаим» - http://www.machanaim.org/tanach/in_tnh.htm
Сайт общества «ORT» - http://bible.ort.org/intro1.asp?lang=2
Сайт «Хасидус» (два разных варианта перевода)
http://chassidus.ru/library/tora_inline/bereyshis/bereyshis.htm http://chassidus.ru/library/tora/kuk/tora/bereyshis/bereyshis.htm
Сайт Тора-он-лайн - http://torahonline.org.ru/bereyshis/bereyshis.htm

Пожалуй, имеет смысл только предупредить, что навигация везде рассчитана на евреев, читавших Тору. Так как расчленение идет по недельным главам, носящим специальные (естественно, еврейские) названия. Незнающим их придется несколько покопытить в поиске - методом случайного или же последовательного тыка.
Нет проблем, конечно, составить табличку перевода, да кажется мне, что то будет зряшная работа – никому не нужная. Как и вышеуказанная полугодовой давности подборка.
--------------------------------

Под конец, пожалуй, еще к профессору, поскольку одна его позиция показалась мне неясной.

Продолжение цитаты, частично приведенной в начале (№2):
[i]К Библии я отношусь бережно, хотя прекрасно понимаю всю условность точной там датировки. Это все могло быть типа Lost in Translation через тысячи лет, и мы просто обсуждаем перевод из фаренгейтов в реомюры, не имея в руках калькулятора, да и формулы перевода тоже.
[/i]
Мне неясна сопряженность «бережного отношения» к Библии и постулирования «условности» ее датировок. Мне, почему-то кажется необходимым условием честного исследования – четкий выбор или той или другой позиции. А вот их сочетание приводит к двусмысленности. По моим представлениям нельзя построить нормальную геометрию, в чем-то «бережно относясь» к постулату Эвклида (параллельные прямые нигде не пересекаются), но одновременно (или следом) заявляя, что в общем-то это условность и, в конце-концов, они (прямые), видимо, где-то пересекутся. Я не прав?



Б.Тененбаум - Инне
- Monday, February 26, 2007 at 15:00:14 (PST)

Позвольте рассказать вам "историю из жизни" :) В 1981 году мы прибыли в Бостон из Москвы, и были как свеже-прибывшие эмигранты приглашены в гости, в некий вполне респектабельный русско-говорящий дом. Английский у меня был если не на нуле, то близко к этому. И вот, сидящий рядом со мной за столом молодой человек обратился к приятелю, и сказал ему следующее: "Дилер говорил мне про тюнап, а я это дело скипнул - и что ты думаешь ? Схожу в экзит, а она -стоп ...". Разговор - теоретически - шел на русском, но понял я не много :)


Inna
- Monday, February 26, 2007 at 14:51:20 (PST)

Б.Тененбауму

Вам не кажется, что меняется сам язык ?
---------------------------
Язык действительно меняется. Вообще-то язык никогда не стоит на месте, а при таких исторических сдвигах меняется особенно бурно. Да, то, что появилось в русском языке за последние годы мне приходится изучать. Но я имела в виду другое: от меня потихоньку уходит и то, что не изменилось. Забываются какие-то синонимы, испаряются какие-то грамматические конструкции. Иногда не знаю, можно так сказать по-русски или нет.


Б.Тененбаум - Игреку :)
- Monday, February 26, 2007 at 14:44:33 (PST)

Мой e-mail: btenenba@gmail.com.
Пожалуйста, пошлите мне какой-нибудь "пинг", и мы сможем обменяться телефонами. Я живу на побережье, North Shore, etc. Был бы очень рад вас увидеть :)


Игрек
- Monday, February 26, 2007 at 14:29:58 (PST)

"Глубокий системный беспорядок" - очень точное замечание. Исторически, так в средне- и послесредневековой Италии было всегда. Прелесть к чему привела их политическая неустроенность и постоянная вражда-дружба друг с другом, буквально одной горки-города с другой (это совершенно наглядно видно именно в Умбрии). Как ни странно, или это как раз и не странно, в сегодняшней действительности такой системный беспорядок оказался предпочтительнее плодов системного полицейского государства, Испании. Где уж если народ созревает до ломки, то сразу получается Гражданская война. Тут, как мне кажется, есть аналогия с землетрясениями. Небольшие системные землетрясения уменьшают вероятность одного большого, катастрофического. И потом, в бардаке нравы, по определению, более терпимые, чем в полицейском участке. Если положить на одну чашку весов неработающие часы на вокзалах Италии и пятьсот различных по стилю колонн, украденных для собора Сан-Марко в Венеции, а на другую работающую как часы испанскую инквизицию и разрушенную гармонию Мескиты в Кордове, то в моем представлении итальянская чаша перевесит. Допускаю, что у католического епископа может быть совершенно противоположное мнение.
Впрочем, уважаемый БТ, мы сможем обменяться нашими "иностранными" впечатлениями за рюмкой чая, подобно тому, как это мы сделали с Буквоедом. Кажется, меня занесет в городок Needham, что на Бостонщине в середине августа. По моему первому посещению этого ничем не примечательного городка у меня сложилось впечатление, что в этом районе Массачуссетта англоговорящие двуногие составляют значительное меньшинство.


Тора для неевреев
- Monday, February 26, 2007 at 14:04:31 (PST)

Один израильский школьник из олимовской семьи спросил меня: "Зачем мне учить Тору, если я не собираюсь проходить гиюр?" В его вопросе четко звучало заблуждение, которым на протяжении многих веков страдали как неевреи, так и отдельные евреи. Заблуждение звучит так: Тора только для евреев. Я ему тогда ответил, что знания Торы ему в жизни пригодятся вне зависимости от его решения стать евреем. Тора, действительно, дана Б-гом еврейскому народу, но не как "конечному адресату", а для того, чтобы евреи обучали человечество Б-жественной Истине. Приведу лишь несколько цитат, говорящих об этом: "... и праведники Твои благословляют Тебя, о славе царства Твоего говорят и о величие Твоем рассказывают, чтобы возвести людям о могуществе и о славном великолепии царства Твоего" (Пс. 145), "Узнают и познают все народы, что Ты, Г-сподь, - Б-г наш" (Исая 64:7). А вот, как начинается один из псалмов, которые левиты пели на ступенях Храма: "Руководителю хора, Псалом сынов Кораха. Слушайте, все народы, внимайте, живущие на земле - простолюдины и знать, богачи и бедняки" (Пс. 49). А вот слова, которые вошли в ежедневную молитву (Алейну лешабэах): "И поэтому мы надеемся на Тебя, Г-подь, Б-г наш. Надеемся увидеть вскоре великолепие могущества Твоего... Чтобы был исправлен мир под властью Б-га. Тогда все сыны человеческие станут взывать к Имени Твоему, и все грешники земли вернуться к Тебе" (Исая 45:23).

Тора дана для всего человечества. Евреи же, получившие Тору от Б-га, должны на практике показать всем, что эти законы полезны и для общества в целом и для человека в частном. За время, прошедшее после дарования Торы, многие Б-жественные истины уже услышаны и восприняты народом мира. Давно канули в прошлое такие вещи, как идолопоклонство и человеческие жертвоприношения. Рассказ Торы о том, что все люди происходят от одного человека и законы отношения к рабу послужили прообразом современных законов о правах человека. А еще провозглашенные Торой идеалы семьи. К сожалению, христианство и ислам, через которых человечество в основном и познакомились с этим, взяли от нас только запреты. В наше время человечество пытается осознать то ценное, что дает человеку семья. А это можно постигнуть или эмпирически, путем проб и ошибок, или путем извлечения мудрости из священных текстов.

Еще пример - суббота. Тут мы узнали от Б-га сразу две вещи: что существует семидневный цикл, и что каждый седьмой день - отдых от производительной работы. В еврейской традиции субботе уделяется большое внимание. Много книг освещают философию и законы субботы. Христианство впитало в себя отдельные идеи, но, чтобы отличаться от евреев, объявило днем отдыха воскресенье. Еще позднее появившийся ислам выбрал своим священным днем пятницу. Сейчас все человечество живет по семидневному циклу с одним выходным днем в неделю. Регулярный отдых входит в список основных прав человека. Многие "позабыли", что этим они обязаны Б-гу, даровавшему Тору еврейскому народу.

Есть разница между Торой, как Источником Б-жественных знаний, и пересказом ее идей другими религиозными системами. Так, например, заповедь "не прелюбодействуй", вошедшая в почитаемые христианством "10 заповедей", воспринимается евреями и христианами по-разному. По Торе за нарушение этого запрета положена смертная казнь. Закон суров и, несмотря на то, что суд по этому вопросу во времена Храма собирался крайне редко, а после разрушения Храма не собирался вообще, сама мысль о смерти, как наказание за разврат, останавливала многих. Согласно же христианской вере, "прелюбодеяние - тяжкий грех", и как бабушки пугают маленьких детей: "Б-женько накажет". Только вот мера наказания в христианстве не указана, поэтому этот запрет носит лишь моральный характер. В результате на постхристианском пространстве из-за супружеских измен до сих пор проливаются реки крови. А сколько еще семей отравлено духом ревности и недоверия. Вот, так получается, что закон Торы, внешне кажущийся более жестоким, на практике оказывается более гуманным к людям.

Другой пример из "10-и заповедей" - "не укради". Только люди, знакомые с Устной Торой знают, что здесь речь идет о краже людей и наказании за это смертной казнью (о краже имущества в Торе тоже говориться, но в другом месте). Кражи людей с целью получения выкупа, а также случай захвата заложников резко участились в последние десятилетие. В случае поимки преступника ожидает максимум тюрьма, а ведь могут и не поймать. Согласитесь, что совсем иначе выглядела бы ситуация, если бы все знали, что по закону Б-га за кражу человека преступника ждет смерть - если поймают, то по суду, если не поймают - то "от рук Небес".

Б-г знает человека лучше, чем сам человек знает себя. Рав Саадия гаон пишет, что законы Торы полезны для человека, и люди придут к пониманию пользы этих законов.

И соблюдение их сделает жизнь на земле лучше.
http://world.lib.ru/t/talxberg_e/toradlaneevreev.shtml


Б.Тененбаум - Игреку, Буквоеду
- Monday, February 26, 2007 at 13:50:17 (PST)

До чего все занятно устроено - мне как раз не нравилось в Италии :) Глубокий систематический беспорядок сильно напоминал Отечество. Я в России учил итальянский, даже экзамены сдал на заочных курсах за три семестра. Не густо, конечно, но все же ... И потом, когда мы уже туристами проехались по Италии от Рима до швейцарского кантона Тичино, я видел презабавную вещь - в Риме на вокзале не шли вокзальные часы. Во Флоренции ону шли, но показывали неправильное время. В Милане часы шли, и врали всего на прау минут. А вот в Тичино (где говорят на том же итальянском) часы шли секунда в секунду :) Наверное, дело не в генетике населения, а в его истории - Габсбурги, при всей их реакционной сущности, немало способствовали тому, что Милан - европейский город, а Рим - когда как :) Но жить, конечно, следует в Тоскане :)


Г. Нейгауз - Недоумевающему
- Monday, February 26, 2007 at 13:37:01 (PST)

Я не бывший русский. Я настоящий гой самых различных национальностей. А ты вали отсюда, не позорь свой народ. Ольмерт с Перецом и без тебя успели опозорить.


Буквоед - Игреку
- Monday, February 26, 2007 at 13:17:46 (PST)

Мне все время казалось, что они - испанцы - не изменились и при случае опять будут собираться жизнерадостными толпами на новые костры инквизиции. Буквоед заметил, что они сейчас другие.
---
Я заметил, что они сейчас другие в связи с капитуляцией после терактов после терактов и только; относительно же того, что они "не изменились и при случае опять будут собираться жизнерадостными толпами на новые костры инквизиции", то ничего сказать не могу, т.к. в Испании никогда не бывал и с испанцами никогда не встречался. Хотя Вы, скорее всего правы, т.к. жестокость часто - оборотная сторона трусости.



Игрек
- Monday, February 26, 2007 at 12:53:16 (PST)

Б. Тененбауму

Уважаемый БТ, региональная разница в архитектуре и убранстве католических соборов Испании и других католических стран, прежде всего - Италии, огромаднейшая. Трудно сказать, что первично: то ли абсолютная централизация власти в Толедо-Мадриде, подавляющая все живое и предписывающая все нормы архитектуры и живописи, убила таланты архитекторов и живописцев, то ли первоначальное отсутствие этих самых талантов. Церковь Испании вплоть до Гражданской войны являлась образцом консерватизма, это если сказать мягко. Я знаю какие серьезные споры (с самими неприятными последствиями для художника) шли по поводу формы гвоздей в ногах у Иисуса и как самых великих испанских художников заставляли переписывать детали на их картинах. Ничего подобного быть не могло в Италии (мелочи - не в счет). Децентрализация власти и часто прямое неподчинение папским указаниям, сам дух независимости как на социальном, так и на художественном уровне, плюс, наверно, генетическая предраспложенность, гораздо более дружелюбный ландшафт и само географическое положение в центре тогдашней Европы (для северной Италии) создали итальянскую архитектуру и живопись другой, бесконечно разнообразной и простите за слово - не скучной. Довольно долго прожив в Италии во времена отказа и проработав гидом на севере страны, я не переставал удивлятся, как разительно могут отличаться соборы в двух соседних городах (Флоренция и Сиена, например. Или Венеция - Падуя - Верона. Или сравните крайности: Милан и Пиза). Недавнее спокойное путешествие по Умбрии и Югу страны только подтвердило это мое старое впечатление.
Что касается Испании, то помню свое впечатление от Толедского собора. Выйдя из него, я сказал жене: "Похоже, что они платили художникам за квадратные метры".
Но, честно говоря, это все вторично. Главное, я чувствовал себя там не в своей тарелке. Что-то метафизическое в воздухе. Что-то давило. История, как личное генетическое неприятие. Скорее всего, личная предвзятость и непрощение на каком-то фрейдовском уровне. Мне все время казалось, что они - испанцы - не изменились и при случае опять будут собираться жизнерадостными толпами на новые костры инквизиции. Буквоед заметил, что они сейчас другие. Может быть, но я не почувствовал.
Наверно, в Испанию надо было ехать в группе с "посмотрите налево, посмотрите направо" гидом, а не так, как мы обычно делаем.
В Италии сегодня тоже многое изменилось. Антиамериканизм заметен, хамство - на каждом шагу, но им я по каким-то малопонятным внутренним причинам это прощаю. (Внимательный читатель, наверняка, обвинит меня в снобизме, но ничего не поделаешь, придется с этим обвинением жить).



AK
Boston, MA - Monday, February 26, 2007 at 12:39:44 (PST)

>Gena, Monday, February 26, 2007 at 12:06:25 (PST)
################

Да, поправка, не меняющая существа дела.

>48 - мутация вверх, от 14 к 15
>3 - мутация вверх, от 14 к 16
>6 - мутация вниз, от 14 к 13

Таким образом, у 57 гаплотипов c мутированным первым маркером только у 6 мутация прошла вниз, примерно 10%. У остальных 90% - мутация вверх.





Буквоед - Б.Тененбауму
- Monday, February 26, 2007 at 12:12:33 (PST)

Его русский был совершенно правильным, но очень книжным, примерно так говорил бы - как мне показалось - кто-нибудь во времена Бунина. Надо полагать, мы тоже отстаем от живого языка, такого, каким он стал в России ?
---
Теоретически так, но слишком мало прошло времени.




Б.Тененбаум - Элле
- Monday, February 26, 2007 at 12:11:18 (PST)

Я попал в Мадрид сразу после Стокгольма, и разница просто бросалась в глаза. Протестантские церкви выглядели строго и аскетично, соборы в Испании - пышно до невозможности добавить что-нибудь еще, все было в завитушках и в позолоте. Самое сильное впечатление оставила старинная мечеть в Кордове, переделанная в церковь. Та часть ее, которая уцелела после варварской "модернизации", просто поразительно красива. Как жаль, что нельзя сьездить куда-нибудь в Дамаск так, как в Стамбул, например. Наверное, можно было бы увидеть немало интересного :)


Gena
- Monday, February 26, 2007 at 12:06:25 (PST)

AK
Boston, MA - Monday, February 26, 2007 at 11:55:36 (PST)


Спасибо. Значит разные мутации даже в одном маркере очень неравновероятны. Интересно.


Буквоед - Б.Тененбауму
- Monday, February 26, 2007 at 12:03:09 (PST)

Наверное, в свое время религиозные страсти в Европе кипели и из-за пышности литургии - стороны не зря считали друг друга еретиками :)
---
Не наверное, а точно. Многие деятели реформации, особенно Кальвин со-товарищи, считали, что пышность литургии есть отход от "истинного христианства", а все эти шикарные интерьеры не что иное, как идолопоклончество.



Б.Тененбаум - Инне Ослон, АЕДу,Буквоеду
- Monday, February 26, 2007 at 12:02:40 (PST)

-----
Но сама я владею русским все хуже и хуже. У Вас нет такого ощущения, что Вы в чем-то теряете язык?
------
Вам не кажется, что меняется сам язык ? В 1981 году я встретил в своем городке в Массачузетсе очень старого человека, который усляшал, как я говорю с дочкой по-русски, и подошел к нам. Он, представьте себе, был бывший юнкер, который защищал Перекоп, и т.д. Его русский был совершенно правильным, но очень книжным, примерно так говорил бы - как мне показалось - кто-нибудь во времена Бунина. Надо полагать, мы тоже отстаем от живого языка, такого, каким он стал в России ?


Элла-Б. Тененбауму
- Monday, February 26, 2007 at 12:00:55 (PST)

Наверное, в свое время религиозные страсти в Европе кипели и из-за пышности литургии - стороны не зря считали друг друга еретиками :)

Вообще-то, по моим наблюдениям, ритупл и бытовая обрядность в жизни любой религиозной общины значат больше, чем догматика. Тут первична разница ментальностей и культур.


AK
Boston, MA - Monday, February 26, 2007 at 11:55:36 (PST)

>Gena, Monday, February 26, 2007 at 11:31:59 (PST)
>Вы пишете, что маркер #19 имеет аллели от 13 до 17, а у Y-хромосомного Адама было предположительно 10. Eсли у всех современных людей этот показатель существенно выше 10, на каком основании делается вывод, что у первоисточника он был 10? Мутация вверх существенно более вероятна, чем вниз?
#################

Да, скорее всего так. 99% людей на Земле имеют аллели этого маркера от 13 до 17. Причем мутации вверх, похоже, значительно более вероятны. Судите сами. У 200 евреев, "потомков 12 колен", мутации у этого маркера следующие (эти данные я скоро дам для публикации в "Заметках"):

92 - мутации исходного гаплотипа (включая этот маркер) вообще нет.
51 - мутации этого маркера нет
48 - мутация вверх, от 14 к 15
3 - мутация вверх, от 14 к 16
6 - мутация вниз, от 14 к 13

Таким образом, у 108 мутированных гаплотипов только у 5-6% мутация прошла вниз. У 94-95% мутация вверх.

Именно на этом основании я условно приписал "Адаму" исходную аллель 10. Просто как пример. Этот маркер мутирует в среднем раз в 12 тысяч лет в одной генеалогической линии.

Да, естественно, в статье я таких рассмотрений, как выше, не делал. Но таблица всех 200 гаплотипов евреев (из данного исследования) будет. Для желающих поиграть с данными.




Дирижер Даниэль Баренбойм: "Политикам легче закупать оружие, чем разговаривать друг с другом"
- Monday, February 26, 2007 at 11:49:03 (PST)

В Москве с двумя концертами побывал Венский филармонический оркестр во главе с одним из самых знаменитых музыкантов мира Даниэлем Баренбоймом. Программу русского визита составили симфония N 4 Шумана и симфонические фрагменты из нескольких опер Вагнера, симфония N 7 Брукнера и 27-й концерт для фортепиано с оркестром Моцарта. С Даниэлем Баренбоймом встретилась обозреватель "Известий" Мария Бабалова.

http://www.izvestia.ru/culture/article3101497/


Дзюдо: Арик Зееви выиграл турнир в Гамбурге
- Monday, February 26, 2007 at 11:40:04 (PST)

В Гамбурге прошел турнир Beim Judo-Otto-World-Cup, являющийся этапом Суперкубка мира. В категории свыше 100 килограмм в этом соревновании победил израильский борец Арик Зееви. В первом туре он победил словенца Приможа Париджана. Затем он победил узбека Отакира Курбанова и японца Кейджи Судзуки....



Роботов учат воспринимать эмоции
- Monday, February 26, 2007 at 11:39:00 (PST)


На днях стали известны детали научно-исследовательского проекта Feelix Growing, объединившего 6 стран и более 25 квалифицированных специалистов по робототехнике, физиологии и неврологии. Главная цель ученых - научить неживых роботов взаимодействовать с человеком на эмоциональном уровне. Координатор проекта Лола Канамеро (Lola Canamero) сказала, что их задача – переступить ту «неживую» грань, которую не могут перейти роботы, поднять уровень общения и взаимодействия между человеком и машиной в социальном и эмоциональном аспекте....

http://redirect.subscribe.ru/media.news.online.vestnikisrael,42909/20070226145826/9913=t7=9919=4979/m1910038/-/vestnik.co.il/2007/02/26/roboti.html


Германец
- Monday, February 26, 2007 at 11:36:57 (PST)

Ион Деген
- Monday, February 26, 2007 at 11:03:40 (PST)
Выдающийся швейцарский археолог, Клод Шаефер, ничего общего с немцами не имеет. Об умляутах у меня есть некоторое представление. И поставленной в упрёк ошибки я бы не совершил.

Уважаемый Ион Деген, даже чистокровный швейцарец Schaeffer (или Schaefer) с немцами имеет то общее, что язык немецкий работает в Швейцарии так же, как и в Германии. И фамилия швейцарская все равно Шеффер (или Шефер), а не Шаефер. ИМХО.


СМИ О КСЕНОФОБИИ И ЭТНОЭКСТРЕМИЗМЕ
- Monday, February 26, 2007 at 11:32:11 (PST)


ДЕЯТЕЛЬНОСТЬ ОРГАНОВ ВЛАСТИ, МЕСТНОГО САМОУПРАВЛЕНИЯ, СТРУКТУР СУДЕБНОЙ СИСТЕМЫ

Прокуратура Санкт-Петербурга возобновила расследование приостановленного ранее уголовного дела о нападении на девочку-мулатку Лилиан Сиссоко в марте 2005 года. У следствия появилась версия о том, что к преступлению может быть причастна экстремистская банда Кислого, костяк которой был арестован весной прошлого года за тяжкие преступления на национальной почве.
http://www.kommersant.ru/region/spb/page.htm?Id_doc=745439

***
Руководство Федеральной службы по надзору за соблюдением законодательства в сфере массовых коммуникаций и охране культурного наследия (Росохранкультура) и эксперты в ходе рабочего совещания выразили озабоченность по поводу роста национальной и религиозной нетерпимости в российских СМИ.
http://www.religare.ru/article38608.htm


ОБЩЕСТВЕННЫЕ ИНИЦИАТИВЫ

В Москве у здания эстонского посольства прошла совместная акция молодежных движений "Россия молодая" и "Новые люди". Поводом для акции послужило заявление президента Эстонии, в котором он сравнил советских воинов с шайкой бандитов.
http://rus.delfi.ee/daily/abroad/article.php?id=15181489

***
Открытый "Урок дружбы", в котором приняли участие студенты из Индии и Африки, прошел в Петербурге. Мероприятие прошло в рамках федеральной программы "Уроки дружбы", реализуемой движением "Наши".
http://www.utro.ru/news/2007/02/22/627440.shtml

***
С 24 февраля по 1 марта в Удмуртской Республике проходит Уральский форум немецкой молодежи. В рамках форума проходят презентация общественной компании «Мой мир без вражды!», направленной на противодействие ксенофобии и нетерпимости, ускорение толерантности и языка мира.
http://susanin.udm.ru/news/view/_t_/id=36122

***
В Научно-Просветительном Центре "Холокост" была проведена экскурсия для школьников 7-11 классов школы "Интеграл". Руководитель образовательных программ НПЦ "Холокост" Леонид Пятецкий рассказал школьникам об истории создания Центра, о конкурсе работ "Память о Холокосте: путь к толерантности". Учащимся школы "Интеграл" был показан фильм "Брестское гетто".
http://www.jewish.ru/news/cis/2007/02/news994246278.php


ЗА РУБЕЖОМ

Прокуратура Рижского судебного округа оштрафовала на 400 латов молодого человека за расистские комментарии в Интернете.
http://www.kompromat.lv/index.php?docid=readn&id=3165

***
Неонацисты изрисовали свастиками и другой нацистской символикой еврейский детский сад в Берлине.
http://www.jewish.ru/news/world/2007/02/news994246274.php

***
Израильская газета "Гаарец" опубликовала статью, посвященную антисемитизму среди выходцев из стран СНГ, живущих в Израиле.
http://www.newsru.co.il/israel/25feb2007/gaarez.html

***
В Латвии действует неофициальная неонацистская организация, представители которой публично заявляют о преследовавшихся Гитлером национальностях, что они "нелюди", которых "в идеальном варианте следовало бы уничтожить". Такие заявления прозвучали во время круглого стола на тему "Проблемы нацизма, неонацизма, расизма и ксенофобии в Латвии", проведённого Латвийским антифашистским комитетом (ЛАК) в рижском Доме Рейтерна.
http://www.regnum.ru/news/787185.html

***
У памятника "Бронзовый солдат" в Таллине (Эстония) группа радикалов-националистов устроила акцию, в ходе которой были растоптаны принесенные к памятнику цветы и опрокинуты поминальные свечи, а пришедшие с цветами люди подвергались словесным оскорблениям.
http://www.regnum.ru/news/787126.html



Gena
- Monday, February 26, 2007 at 11:31:59 (PST)

Уважаемый АК,

Большое спасибо за новую статью. У меня вот какой вопрос:

Вы пишете, что маркер #19 имеет аллели от 13 до 17, а у Y-хромосомного Адама было предположительно 10. Eсли у всех современных людей этот показатель существенно выше 10, на каком основании делается вывод, что у первоисточника он был 10? Мутация вверх существенно более вероятна, чем вниз?


Б.Тененбаум - Игреку, с запозданием, к вопросу об Испании :)
- Monday, February 26, 2007 at 11:27:23 (PST)

Я прочитал ваш пост об Испании, но воле обстоятельств оказался вне cyber space на оба выходных дня. Я обнаружил, что и у меня есть негативные испанские впечатления - во-первых, немыслимое количество "Hamon" - любовь к ветчине в Мадриде превосходит все возможные ожидания :) Во-вторых, Madonna Bianca в соборе Толедо. Конечно, ритуал критиковать не следует, но трудно понять, почему процессия с раскрашенной куклой на носилках считается христианской. После Скандинавии большие соборы в Испании, изукрашенные чем только можно до последнего квадратного сантиметра, кажутся скорее языческим храмами. Наверное, в свое время религиозные страсти в Европе кипели и из-за пышности литургии - стороны не зря считали друг друга еретиками :)


Редактор
- Monday, February 26, 2007 at 11:25:42 (PST)

Недоумевающий
- Monday, February 26, 2007 at 07:29:04 (PST)
Главное здесь - бесконечные и крайне пристрастные, недоброжелательные (это еще оч-чень мягко сказано) обсуждения России, ее истории, культуры.


Уважаемый Недоумевающий, спасибо. что бдите. Назовите конкретно русофобскую статью в журнале или альманахе, и мы наложим на автора и выпускающего редактора строжайшую эпиталаму.

Кстати, можно было бы спросить, что на этом русофобском сайте забыли Клесов и Нейгауз.

Ответ простой: им интересно. Вам, чувствуется, тоже.
Удачи!



Gena
- Monday, February 26, 2007 at 11:22:02 (PST)

Большое спасибо, Модератор.


Gena
- Monday, February 26, 2007 at 11:20:12 (PST)

Нестор
- Saturday, February 24, 2007 at 09:38:58 (PST)
Я укрепился в прежнем, давнем решении: пока не будет принесено официальных и публичных извинений за публикации работ Попова, Буровского и Рубенчика (о Шостаковиче), ни я, ни мой alter ego писать в «Лебедь» не будет.


Браво!!!


МИМОЛЕТОМ
- Monday, February 26, 2007 at 11:07:43 (PST)

Сомневающемуся
Нет, не такой уж Матроскин пьяный, чтобы опохмеляться.
А, вот Вы - батюшка наш милосердный, не отклоняйтесь от прямого ответа на прямые вопросы.
Вот уже более 1000 лет великий русский народ страдает и горюет в рабстве из - за таких, как Вы, лжепатриотов.
Вы, любезный, не на еврейских сайтах паситесь, а возвращайтесь на СВОЮ родину в Россию и работайте во благо голодающего народа вашего. Вытаскивайте его - народ ваш - из пьянства, лени, безразличия.
А ЕВРЕИ СО СВОЕЙ ИСТОРИЕЙ И КУЛЬТУРОЙ САМИ РАЗБЕРУТСЯ БЕЗ ВАШИХ УКАЗАНИЙ!
За работу, товарищ!


Ион Деген
- Monday, February 26, 2007 at 11:03:40 (PST)

Прошу прощения за поздний ответ. Я далеко от дома и редко имею доступ к интернету.
Поэеому не помню инициалов господина, задавшего мне вопрос по поводу имени Великовского и написания фамилии швейцарского учёного.
У Шимана Великовского было три сына — Александр, Даниэль и Эмануэль. Др. Эмануэль Великовский начал публиковать свои медицинские статьи в европейских журналах в конце 20-х годов. Но основные публикации — статьи и книги в США — с 40-х годов. Имя “Эммануэль“ американцами произносится как ”Иммануил“.
Выдающийся швейцарский археолог, Клод Шаефер, ничего общего с немцами не имеет. Об умляутах у меня есть некоторое представление. И поставленной в упрёк ошибки я бы не совершил.

С уважением,

И. Деген


Элла
- Monday, February 26, 2007 at 10:53:33 (PST)

Алекс сообщил "Гаарец", что эмиграция евреев из России в Израиль "является лучшим решением еврейского вопроса в России", тогда как отъезд русских – это "ошибка, которую мы хотим исправить".

Предположим, этот Алекс и вправду антисемит и вообще редиска, но... в данном случае он, похоже, таки прав.


Недоумевающий
- Monday, February 26, 2007 at 10:47:06 (PST)

Матроскин
- Monday, February 26, 2007 at 09:42:01 (PST)

Этот поток сознания полностью подтвердил то, о чем я писал.


\\\Так, чего-то я притомился, пойду на озаправку.\\\

Да-да, идите, опохмелитесь, авось полегчает.
 


"Гаарец": русские антисемиты в Израиле пропагандируют нацизм
- Monday, February 26, 2007 at 10:26:24 (PST)


http://www.newsru.co.il/israel/25feb2007/gaarez.html

Газета "Гаарец" опубликовала сегодня статью, посвященную антисемитизму среди выходцев из стран СНГ, живущих в Израиле.

Издание напоминает о скандальном деле Ильи Злотова, имевшего место в 2003 году. Злотов, служивший в Армии обороны Израиля, создал интернет-сайт, содержавший материалы с пропагандой нацизма и отрицанием Холокоста. Сайт размещался на израильском сервере и был закрыт властям. Злотова приговорили к общественным работам и отправили в поездку по бывшим нацистским лагерям смерти в Польше.

Его единомышленники, продолжает "Гаарец", действуют более осторожно. Сайт "Русский национальный центр", так называемого общественного объединения русских националистов в Израиле, размещается на российском сервере. Администратор сайта Алекс (имя вымышленное) утверждает, что антисемитской пропагандой не занимается. По его словам, это движение ставит своей целью поощрять русских граждан Израиля возвращаться в Россию, и одновременно убеждать евреев оставаться в Израиле.

"Гаарец" утверждает, что антисемитские материалы на сайте www.rusnatcentre.tk все-таки размещены, а также подчеркивает, что Алекс активно выступает на других неонацистских форумах, где, в частности, рекомендует книги, отрицающие Холокост.

Алекс сообщил "Гаарец", что эмиграция евреев из России в Израиль "является лучшим решением еврейского вопроса в России", тогда как отъезд русских – это "ошибка, которую мы хотим исправить".


Модератор
- Monday, February 26, 2007 at 09:55:36 (PST)

Gena
- Monday, February 26, 2007 at 08:37:39 (PST)
Куда подевался архив за вторую полвину прошлой недели?


Уважаемый Гена, архив на месте, просто решил немножко поиграть в прятки. Есть еще одно место, где можно его найти: под кнопкой "Архивы" строчка "Архив гостевой". И там есть:
 

...

Сейчас ссылка на шестую часть архива за февраль стоит везде, где нужно. Спасибо за внимательность.
Удачи!


Авигдор Эскин: Пригласить в Израиль Ахмеда Закаева!
- Monday, February 26, 2007 at 09:46:18 (PST)

Сегодня начался двухдневный визит в Москву главы палестинских душегубцев Халеда Машаля. Тучный и бесноватый мулла постарается убедить российских собеседников в необходимости оказания поддержки его бандитской структуре. Если хватит ему ума, то напомнит о неведомом по дерзостности намерении США установить ракеты на территории Чехии и Польши под предлогом «защиты от иранской угрозы»… И сравнит инициативу Буша с попыткой дислокации советских ракет на Кубе, приблизивших мир к ядерной войне. А потом заговорит о балансе сил и о необходимости укрепить «Палестину» в противовес проамериканскому Израилю.

Роман с Хамасом может найти оправдания с точки зрения интересов России в пору разгула разнузданного глобализма. Желающие оправдывать вепревые плясалища с бесноватыми могут сказать с немалой долей справедливости, что правительство Израиля видится сегодня скопищем недалеких и коррумпированных временщиков. Но мы не станем утруждаться копанием в содержимом мутных голов, занятых оправданием низменной потребы в союзничестве с наиболее омерзительными средь мерзких из кровавых дикарей Ишмаэля. Лучше поделюсь собственной мутной мыслью при виде кадров приема Машаля в Москве.

Живет себе в Лондоне один из главарей чеченских бесноватых Ахмед Закаев. Как и лидеры Хамаса, он был избран своим народом самым демократическим путем. Как и душегубцы в наших местах, он возвеличился благодаря горам трупов и призывов к самостийности и исламизму. Запад – где закат. Там любят трупные запахи и охотно признают Хамас и чеченцев.

Но коли наши враги бражничают в Москве, то почему нам не пригласить в Тель-Авив Ахмеда Закаева? Я слышал, что его друг Буковский давно уже носится с такой идеей. Нет, его не будет приветствовать израильский премьер. Как Путин брезгливо избегает хамасовских бесноватых, мы направим чеченских головорезов в наш МИД. Там с ними поговорят об угрозе со стороны Ирана (этот шиитский зверь угрожает ведь как Израилю, так и ваххабитам…) Кстати, к чеченцам можно присоединить и Гедара Джемаля. Тогда пусть наши мидовцы убеждают его признать право России на существование и в тот период, который будет предшествовать ее полной исламизации.

И не забудьте сказать чеченским гостям, что мы против террористических действий, жертвами которых становятся мирные граждане. Российский МИД так говорит, если я не ошибаюсь… Но банда Закаева была воцарена вполне демократически. И как нам не вести с ней переговоры?..

Мысли мутные, но лезут в голову так назойливо, что не смог не поделиться ими. Скажите мне, разве у вас не возникло в эти дни желания пригласить Закаева в Тель-Авив? И тут мне верно подсказали: это было бы грамотным ответом русским на прием бесноватых, но себя нам зачем наказывать Закаевым и прочими головорезами?..


Матроскин
- Monday, February 26, 2007 at 09:42:01 (PST)

Недоумевающий - Матроскину
- Monday, February 26, 2007 at 08:06:24 (PST)
У Вас, увы, проблемы с пониманием простейших вещей. Я говорил о недоброжелательном (мягко говоря) отношении к России, ее истории и культуре. Владение русским языком ни в коей мере не свидетельствует об уважении к России, ее истории и русской культуре.
х х х х х х х

Под индюшачий холодец со свежайшим термоядерным хреном орокаградусная настящая сливянка проваливается, как в пропасть. После чего трудно вести разъяснительную работу.

Значит, я должн 24/365 петь осанну России. Так? Боже спаси сказать чего-нибудь, чо может быть понято, как недоброжелательность к супер державе. Так?

А в это время дорогая супер-пупер Россия крышует небритого ублюдка ахмадинеджадку, но я не имею права говорить, что это некрасиво. Хотя этот говнюк открытым текстом посылает всех по известному адресу, и добывает обогащенный уран для мирной, но не существующей атмной энергетики Ирана. Что не мешает той же России поставлять ему ракетно-зенитные комплексы. Но, это исключительно правильно и хорошо! Не так ли?

Резюме: пока Россия будет вести себя, как нацист-шизофреник с маниакально-депрессивным психозом, до тех пор я считаю вполне корректным называть вещи своими именами. Если Россия, заработав три копейки на продаже углеводорода, решила считать себя супр державой, это ее дело А я мею право заметить, что она путает геометрию с величием. А на самом деле Россия по всем показателям - развивающаяся страна где-то между Португалией и Зимбабве.

Так, чего-то я притомился, пойду на озаправку.


Gena
- Monday, February 26, 2007 at 08:56:54 (PST)

Уважаемый Онтарио,

Я получил от знакомого раввина следующую ссылку:

מקרא משנה תלמוּד ואגדה אפֿילוּ מה שתלמיד ותיק עתיד להורות לפֿני רבו כּבר נאמר למשה בסיני (תלמוּד ירושלמי פּאה ב:ד

Перевод: Писание, Мишна, Талмуд, включая агаду, и даже то, что какой-нибудь талантливый ученик в будущем выведет перед своим учителем, было сказано Моисею на Синае (Иерусалимский Талмуд, Пэа, 2:4).

Это подтверждает то, что я всегда знал: ВСЯ устная Тора, от Мишны, до галахических постановлений современных нам авторитетов, была дана на Синае.

Я остаюсь в недоумении относительно разделения на данное на Синае (до р.Акивы) и выведенное из данного (после р. Акивы), которое провели Вы.

Здесь, по-видимому, какое-то недоразумение.


Gena
- Monday, February 26, 2007 at 08:37:39 (PST)

Куда подевался архив за вторую полвину прошлой недели?


Буквоед - АЕД
- Monday, February 26, 2007 at 08:31:44 (PST)

Мы стали американцами в своей внешней оболочке, оставаясь русскими под этой оболочкой. Лишь единицы ещё в России крепко держались за свою еврейскую культуру, действительно оставаясь евреями в окружающей их среде.
---
Я имел в виду, что мы евреи по своему этническому сознанию, т.е. нам еврейские проблемы ближе, чем, скажем, татарские (не в обиду татарам будь сказано, т.к. им их, татарские, проблемы ближе еврейских). Именно поэтому меня, например, российская политика волнует с точки зрения "а как это для евреев", всё остальное я оставляю русским: это их страна, им в ней жить и не мое дело их учить.



Буквоед ERRATA
- Monday, February 26, 2007 at 08:24:49 (PST)

Вместо "жалок НАРОД" надо читать: "жалко НАРОД"



Буквоед - Недоумевающему
- Monday, February 26, 2007 at 08:23:36 (PST)

Главное здесь - бесконечные и крайне пристрастные, недоброжелательные (это еще оч-чень мягко сказано) обсуждения России, ее истории, культуры.
---
Если вы считаете, что ОБЪЕКТИВНЫЙ разговор о России, включая ее историю, культуру, политику, есть русофобия, то мне вас искренне жаль, т.к. из Вашей логики исходя, к русофобам относятся, те, кого по праву считают ГОРДОСТЬЮ русской нации и русской культуры: Чаадаев, Салтыков-Щедрин, Соловьев, Толстой, Белинский, Герцен и многие другие гении русского народа. Русофобы же те, кто предпочитают судить о своей стране и о своих истории и культуре по принципу "православный русский воин не считая бьет врагов" или "наши дураки самые глупые в мире". Пожалуйста, не отождествляйте Россию Николая I с Россией Пушкина и Белинского и Россию товарища Сталина с Россией героев-фронтовиков. Касательно же сегодняшней России, то хочется ошибиться, но нынешний режим ведет ее народ к большим катаклизмам, если не к катастрофе, что здесь и говорят, т.к. нам жалок НАРОД, а не гебисткую камарилью плюс прикормленных ею "жирных котов", пусть даже еврейского происхождения.



Недоумевающий - Недоумевающему
- Monday, February 26, 2007 at 08:20:07 (PST)

А где вы видели пренебрежительное отношение к России на этом сайте? Если и есть отдельные высказывания, они никак не представляют общую картину.

Не обощайте, иначе сам обобщён будешь.


АЕД
- Monday, February 26, 2007 at 08:16:07 (PST)

Буквоед - Monday, February 26, 2007 at 06:48:37 (PST)
я своим детям по приезду в Америку запретил говорить по-английски между собой: они и теперь говорят по-русски без акцента

Запретами, как правило, мало что добиваешься. Мы делали по-другому: просто «не понимали», когда дети начинали с нами говорить по-английски.

при всем при том, я им внушил, что говорить по-русски не значит быть русским: американцы не канадцы, а австралийцы не англичане, хотя и говорят на одном языке, - что мы евреи, а не русские

Мы стали американцами в своей внешней оболочке, оставаясь русскими под этой оболочкой. Лишь единицы ещё в России крепко держались за свою еврейскую культуру, действительно оставаясь евреями в окружающей их среде. Они остались евреями и в Америке. Есть категория людей, ушедших в еврейство, часть из них искренне. Но заметная часть ушла в еврейство по меркантильным соображениям. Это тоже имеется.

Inna
- Monday, February 26, 2007 at 07:28:16 (PST)

мои дети тоже между собой говорят по-русски, хотя никто им не запрещал говорить по-английски.

Это непростой вопрос. Да, пока дети находятся, в основном, в русскоязычной среде, они будут говорить по-русски. Но по мере роста наши дети проводят большинство времени в англоязычной среде (школа, университет, работа), русский язык отходит на второй план. Со временем дети начинают общаться между собой по-английски, хотя НИКАКИХ проблем с русским ни у кого нет. Им просто ЛЕГЧЕ общаться по-английски.

Это я наблюдал на примере своих сыновей. (прошу прощения за обобщение на основе малов выборки). Старший приехал в 16 лет, окончив школу в России. Понятно, что проблем с русским у него не было. Младший приехал в 6. Дома – только русский. Мы его учили русскому по русским учебникам, он читает, пишет по-русски, говорит (практически) без акцента. Причём акцент стал появляться относительно недавно, когда он всю неделю проводит в университете, т.е. в англоязычной среде. Братья до последнего времени общались между собой только по-русски, но последние 2-3 года перешли на английский: им это легче. Рычание не помогает – они уже в том возрасте, когда отвечают за себя сами. Поэтому русский, оставаясь важным языком в их культуре, отходит на второй план.

Но сама я владею русским все хуже и хуже. У Вас нет такого ощущения, что Вы в чем-то теряете язык?

Да, такое чувство есть. Кстати, общение на русских форумах, чтение литературы на русском помогает восстановить язык или держать его на приличном уровне.


Недоумевающий - Матроскину
- Monday, February 26, 2007 at 08:06:24 (PST)

У Вас, увы, проблемы с пониманием простейших вещей. Я говорил о недоброжелательном (мягко говоря) отношении к России, ее истории и культуре. Владение русским языком ни в коей мере не свидетельствует об уважении к России, ее истории и русской культуре.
Чтобы Вам стало яснее: один мой знакомый, израильский араб, гражданин Израиля, высказывается об Израиле и евреях... кхм... как бы это помягче выразиться... не совсем хорошо.
Так яснее?



Буквоед - Inna
- Monday, February 26, 2007 at 07:59:49 (PST)

Но сама я владею русским все хуже и хуже. У Вас нет такого ощущения, что Вы в чем-то теряете язык?
---
Наверное. Практики-то нет: на работе английский, ТВ на английском, разве что читаю на двух языках, но современные книги и статьи с их "турков" и прочими перлами (о том, что можно услышать на РОССИЙСКОМ ТВ я не говорю), от коих наша учительница русского языка Нина Яковлевна Волосюк пришла бы в ужас, не улучшают знаний языка.



Матроскин - славянскому русофобу
- Monday, February 26, 2007 at 07:51:40 (PST)

Недоумевающий
- Monday, February 26, 2007 at 07:29:04 (PST)

Мдя... Вот интересно, записи, подобные этой, занимают здесь процентов 60-70. В них нет ничего о "еврейской истории и культуре". Вроде бы этому, то есть "еврейской истории и культуре" посвящен этот сайт, если я не ошибаюсь?
Скорее всего ошибаюсь. Главное здесь - бесконечные и крайне пристрастные, недоброжелательные (это еще оч-чень мягко сказано) обсуждения России, ее истории, культуры. Как говорится, "Б-г" им в помощь.
х х х х х х х х

Мля! Ну, не дают получить удовольствие!

Стало быть, если ЕВРЕИ на РУССКОЯЗЫЧНОМ сайте, признающиеся в ОБУЧЕНИЕ СВОИХ ДЕТЕЙ РУССКОМУ ЯЗЫКУ, автоматически зачисляются за это в недоброжелатели России, то по той же логике Недоумевающий славянин является русофобом на 100%. И, заодно, одноклеточным по умственному развитию.

Матроскин
Коперанг.


Inna
- Monday, February 26, 2007 at 07:42:53 (PST)

Недоумевающий, а Вы бывший русский, настоящий русский, будущий русский или русский из будущего?


Матроскин
- Monday, February 26, 2007 at 07:38:00 (PST)

С ленты новостей - без комментариев
- Monday, February 26, 2007 at 06:20:01 (PST)
= = = = = =

Безобразие! Забыли добавить, что топливо для дозаправки бесплатно и в неограниченном количестве дает Саудовская Аравия.

Пойду по этому поводу приму еще 150 и закусь.


Недоумевающий
- Monday, February 26, 2007 at 07:29:04 (PST)

Буквоед - Ontario14
- Monday, February 26, 2007 at 06:48:37 (PST)

Мдя... Вот интересно, записи, подобные этой, занимают здесь процентов 60-70. В них нет ничего о "еврейской истории и культуре". Вроде бы этому, то есть "еврейской истории и культуре" посвящен этот сайт, если я не ошибаюсь?
Скорее всего ошибаюсь. Главное здесь - бесконечные и крайне пристрастные, недоброжелательные (это еще оч-чень мягко сказано) обсуждения России, ее истории, культуры. Как говорится, "Б-г" им в помощь.
Только вот почему эти господа, бьющие рекорд за рекордом в такой славной дисциплине, как русофобия, удивляются антисемитизму, - сие есть тайна, покрытая мраком.
Кстати, можно было бы спросить, что на этом русофобском сайте забыли Клесов и Нейгауз.
Но этого можно не делать: ибо они бывшие русские.


Inna
- Monday, February 26, 2007 at 07:28:16 (PST)

И я своим детям по приезду в Америку запретил говорить по-английски между собой: они и теперь говорят по-русски без акцента и без этого ужасного брайтонского "послайсайте маленькими писочками".
-----
Буквоед, мои дети тоже между собой говорят по-русски, хотя никто им не запрещал говорить по-английски. Считается, что в Америке дети теряют язык (так оно чаще всего и происходит, когда родители, из самых добрых, но невежественных побуждений, говорят с ними на своем искусственном английском), но мой младший сын, приехавший сюда в пять лет, говорит по-русски все лучше и лучше Я думаю, это отчасти связано с тем, что мы с ним говорим на все более сложные темы.
Но сама я владею русским все хуже и хуже. У Вас нет такого ощущения, что Вы в чем-то теряете язык?



Матроскин (знатокам русской грамматики)
- Monday, February 26, 2007 at 07:25:55 (PST)

СорокАножка - новейшая разработка концернов "Рафаэль" и "Нортроп": гиперзвуковая сорока повышенной проходимости вертикального взлета. Имеет 40 ног, 2 ТРД, глаза ночного видения и несет в хвостовом оперении 6 ракет воздух-земля с разделяющимися головными частями индивидуального наведения на Ахмадинеджада. :)))


Матроскин [(размышлизм №3) секретный]
- Monday, February 26, 2007 at 07:09:45 (PST)

Сколько колен у сороканожки? А если она еврейка? :)


Матроскин (размышлизм №2)
- Monday, February 26, 2007 at 07:06:49 (PST)

При объединении для эмиграции однозначно становятся объяснимыми ранее вопросительные 600 000 воинов.


Матроскин (размышлизм)
- Monday, February 26, 2007 at 07:01:18 (PST)

Первым и самым главным показателем благополучия зверушков в зоопарке является показатель их воспроизводства.

Судя по всему, евреям в Египте быо очень хорошо, то есть египтяне относились к ним чрезвычайно дружественно.

Если "10 казней египетских" суть последствия мега извержения вулкана Санторини, то в Египте создалась ситуация "спасайся, кто может!". С учетом сложившихся добрых отношений, почему было не объединить усилия в бегстве из умирающей страны в поисках нового пристанища? Тем более, что при совпадении всех остальных интересов, коммуникационных проблем не должно было быть.


Буквоед - Ontario14
- Monday, February 26, 2007 at 06:48:37 (PST)

А русский язык - сложный и странно звучащий. Ну не аттрактивен он для детей, как французский или испанский. Даже арабский более музыкален, чем русский.
И прожить без Достоевского можно. И нужно. Это мне так... каэтцца.
Самое смешное, что написал всё это я,- человек заставляющий своих детей учить русский и иврит :-)))
---
Русский, конечно, безумно сложный язык, насчет его музыкальности или немузыкальности не мне с ухом, под медведя попавшим, судить, но многие американцы, которые слышат русскую речь, восхищенно говорят: "Какой красивый язык!"
****
И прожить без Достоевского можно. И нужно. Это мне так... каэтцца.
---
Правильно каэтца. Достоевского, как Маркеса, как Амаду, как Бальзака, как Гамсуна, как других великих и величайших писателей, надо читать и знать, но считать его "своим" - классический асемитизм, как, впрочем, и требование сделать русский официальным языком Израиля.
*****
Самое смешное, что написал всё это я,- человек заставляющий своих детей учить русский и иврит :-)))
---
Ничего смешного в этом не вижу: знание языков - богатство, которое инфляции не подвержено. И я своим детям по приезду в Америку запретил говорить по-английски между собой: они и теперь говорят по-русски без акцента и без этого ужасного брайтонского "послайсайте маленькими писочками". Но при всем при том, я им внушил, что говорить по-русски не значит быть русским: американцы не канадцы, а австралийцы не англичане, хотя и говорят на одном языке, - что мы евреи, а не русские и русскими НИКОГДА не были и теперь подавно НЕ БУДЕМ.



С ленты новостей - без комментариев
- Monday, February 26, 2007 at 06:20:01 (PST)

Три арабских государства – Катар, Оман и Арабские Эмираты готовы предоставить Израилю воздушный коридор для нанесения ударов по ИрануОб этом сообщает газета "Гааретц" со ссылкой на кувейтскую прессу. По данным из дипломатических источников, представитель одной из трех арабских стран дал понять американскому руководству, что арабы не будут против, если Израиль обратится к ним с соответствующей просьбой.

Ранее в британской прессе появились сообщения о том, что Израиль просит США не препятствовать ему в уничтожении иранской атомной промышленности и научных центров.




AK
Boston, MA - Monday, February 26, 2007 at 06:02:40 (PST)

>Ontario14, Monday, February 26, 2007 at 04:43:20 (PST)
>Участникам дискуссии по проблемам генетики и Исхода:
не помню, упоминал ли кто-то о "Эрев рав" - большом количестве египтян, ушедших с евреями и причисленных Моше к Народу Израиля.
######################

Упоминали, но не как именно "египтян", а как "И множество разноплеменных людей вышли с ними" (Исх. 12:38).

В связи с этим я задавал вопрос, но не получил ответа - входили ли эти "разноплеменные" в число переписи, дважды проведенной у наличного военнообязанного мужского состава в ходе странствований Моисеем и Аароном, первый раз во второй год после Исхода, в пустыне Синайской, второй раз на равнинах Моавитских, у Иордана. И если так, то они и воевали плечом к плечу с потомками 12 колен, и выступали совместно под боевыми штандартами.

Кстати, возможно, о "разноплеменных", или, вполне возможно, именно о египтянах говорят данные ДНК-генеалогии, по которым в гаплотипах евреев присутствуют два совершенно различных типа аллелей (то есть повторов определенных участков ДНК, которые и используются для идентификации типа генеалогии). Если у потомков 12 колен основной, базовый (или корневой) такой

14-16-23-10-11-12

то у очень многих других - такой (обратите внимание на число 12 по втором маркере)

14-12-24-10-13-13

тлт его близкие варианты. Это может быть "тюркский" гаплотип (у хазар, возможно, были такие же). Похожий - у многих самаритян:

14-12-24-11-11-13

и многих арабов, турок

14-12-23-10-14-13
15-12-22-10-10-14

эфиопов

15-12-21-10-12-13

пакистанцев

14-12-23-10-14-11

алжирцев, иранцев, узбеков и т.д.

Вот и разноплеменные.




Ontario14
- Monday, February 26, 2007 at 04:43:20 (PST)

Участникам дискуссии по проблемам генетики и Исхода:
не помню, упоминал ли кто-то о "Эрев рав" - большом количестве египтян, ушедших с евреями и причисленных Моше к Народу Израиля.


Испанский король в изгнании
- Monday, February 26, 2007 at 03:58:33 (PST)

Приехали. Стало быть, Гусинскому можно, а мне нельзя. Это уже свинство. Чем ему тут плохо?! Олигарх чертов. Щас он нынешнего короля купит с потрохами и все. Делов-то, как два пальца... С его лимонами. А нашему-то, нашему?! За меня все сайты голосуют! Даже нервнобольные из музыкальных форумов! Я так и знал, что скоро начнутся провокации. Но не ожидал, что так быстро. Я даже в Арад смылся, потому что тут больше сефардов. И все теперь зря, да?! Пойду, напьюсь...


AK
Boston, MA - Monday, February 26, 2007 at 03:47:10 (PST)

>Игрек, Sunday, February 25, 2007 at 23:14:21 (PST)
>>АК
>...сказано, что "исход произошел в 13 столетии и был закончен около 1225 года". Там же сказано, что не все братья (колена) ушли в Египет (теория весьма известная). Несколько братьев (колен, конечно), от 4 до 6, провели все время "египетского пленения" в землях хаананских.
##################

Спасибо, это еще один "кластер". Если сопоставить год смерти Иакова (1505 год), приводимый здесь раньше, и накинуть известные 17 лет, которые Иаков прожил в Египте, то он с семейством пришел в Египет в 1522 году. Если Исход был в 1225 ("около"), то они провели в Египте 297 лет.

На самом деле это никак не влияет на генеалогическое построение материала в статье, равно как и то, где физически были братья и колена в те времена. Я пытался найти наименее противоречивые (друг с другом и с моими расчетами) даты жизни братьев, и обрисовать библейскую канву в рассказе, чтобы цифры и даты были не сами по себе, а легче воспринимались при чтении. К Библии я отношусь бережно, хотя прекрасно понимаю всю условность точной там датировки. Это все могло быть типа Lost in Translation через тысячи лет, и мы просто обсуждаем перевод из фаренгейтов в реомюры, не имея в руках калькулятора, да и формулы перевода тоже.




Израильский бомж пытался угнать самолет в Россию
- Monday, February 26, 2007 at 03:37:32 (PST)

26.02 13:21 | MIGnews.com
Полиция Израиля задержала нового репатрианта из СНГ, который пробрался за ограждение одного из аэропортов в центре страны. Сорокалетний бездомный мужчина признался, что хотел угнать самолет, чтобы вернуться на нем "домой", в Россию.

Бомж, Яков Моровник, был доставлен на допрос в отделение полиции центрального округа Израиля. После небольшого расследования, преступник был признан неопасным и освобожден. Однако уже через несколько часов его вновь доставили в полицию.

Патруль заметил Моровника, когда тот пытался угнать автомобиль. На этот раз репатриант заявил, что собирался взломать машину, чтобы переночевать в ней. У полиции не осталось выбора и русскоязычный израильтянин переночевал в тюрьме. В ближайшее время правоохранительные органы попросят у суда продления срока его задержания.



Тартаковский.
- Monday, February 26, 2007 at 02:24:18 (PST)

Игрек
- Sunday, February 25, 2007 at 23:14:21 (PST)

АК
В книге Paul Johnson "A History of the Jews", книге весьма тщательно и аргументировано написаной, сказано, что "исход произошел в 13 столетии и был закончен около 1225 года". Там же сказано, что не все братья (колена) ушли в Египет (теория весьма известная).

>>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<<<<<

Евреи, действительно, 40 лет странствовали по пустыне.
Но не все сразу.
Мысль не моя.


Не кормите тролля...
- Monday, February 26, 2007 at 01:57:12 (PST)

Так сложилось, что подобных персон в Интернете называют троллями. От слова trolling. Современное значение термина впервые появилось в конце 80-х и происходит от trawling (травление, ловля на мормышку). Кроме того, в скандинавской мифологи троллями называли злобных созданий, причинявших вред. В Интернете же тролль - человек, совершающий провокационные действия в сети, мешающий дискуссиям. Мотив троллей один - они пытаются привлечь внимание к собственной персоне. В Википедии эти люди описываются так: "Тролль хочет почувствовать свою значительность и популярность, произвести неизгладимое впечатление, и для этого пускает в ход любые средства. Обычно это люди, страдающие комплексом неполноценности, разочарованные или уставшие от повседневной рутины". Часто trolling используется для отвлечения от острых тем, и перевода дискуссии в банальную перепалку.

Самый эффективный метод борьбы с троллями - игнорирование его, в противном случае любая реакция позволяет провокатору дальше действовать на нервы пользователям. В форумах для предупреждения участников прямо так и пишут: "Пожалуйста, не кормите тролля".

Собственно, кроме игнора, есть и другая эффективная мера - модерация. Если Алкснис хочет инициировать законопроект, который, мягко говоря, придется не по душе большей части юзеров, то что мешает юзерам прибегнуть к ответным мерам - обратиться в СУП с просьбой засуспендить аккаунт Алксниса? Пусть "работает с электоратом" в другом месте. Если он решил ограничить права других людей из-за чувства мести, то что мешает пользователям из таких же соображений ограничить его собственные права? Ничто.

http://www.russ.ru/politics/lyudi/ne_kormite_trollya


Ot Ktotova
- Monday, February 26, 2007 at 00:50:34 (PST)

Церковная археология - увлекательная наука, как и всякая археология. Богослов может себе игнорировать реальность - иногда кажется, что в этом весь смысл богословия. Археолог имеет дело с предметом, в котором есть иногда поразительная неумолимость. Из обилия ситечек в кладах с церковными вещами археолог делает вывод: вино, которое в древности использовали для причастия, было такого скверного качества, что его надо было процеживать.

Один "богослов" с восторгом попрекал католиков, что они не добавляют в вино воды: мол, даже в знаменитом письма Плиния Младшего упоминается, что вино для церковной службы разбавлялось. Верно, упоминалось. Только это доказывает одно: вино было не очень хорошее, смолистое. Обычай разбавлять такое вино - не христианский, возник намного раньше, наверное, когда решили выпить по второму стакану такого вина.



"Лоуренс Аравийский мечтал о национальном государстве для евреев"
- Monday, February 26, 2007 at 00:46:25 (PST)

Лоуренс Аравийский, английский офицер, поднявший арабов на восстание против Оттоманской империи, в действительности мечтал о еврейском государстве, которое бы простиралось "от реки Иордан до моря". Человек, который остался в истории как поборник независимости арабов, на самом деле относился к арабам "с некоторым презрением". Таково мнение британского историка Мартина Гилберта, который опубликовал в газете Jerusalem Post некоторые фрагменты своей книги "Черчилль и евреи", ожидаемой на прилавках книжных магазинов в ближайшее время. Лоуренс, по словам Гилберта, верил в то, что лишь еврейское государство может помочь арабам "сделать что-то для самих себя".
Иными словами, борец за права арабов, офицер вооруженных сил Ее Величества, всегда носивший джеллабию, как его изобразил Питер О'Тул в фильме Дэвида Лина, был по сути, "убежденным сионистом". Он был уверен в том, что Израильское государство – единственная надежда для арабов Палестины. Если бы существовало еврейское государство, оно привело бы арабов в современность, принесло бы "дрожжи", как он это называл, которые бы помогли арабам войти в ХХ век. По мнению Гилберта, Лоуренс хотел, чтобы "еврейское государство простиралось от берегов Средиземного моря до реки Иордан" и, как говорит автор, был убежден, что в таком виде оно "никогда не исчезнет".

"Откровения" Гилберта были восприняты в Израиле с некоторой отчужденностью. Мнения читателей той же Jerusalem Post разделились. Некоторые, выступая на сайте газеты, хотели напомнить, что теории британского писателя противоречат теориям таких ученых, как Майкл Оурен, Митчелл Бард, Дэвид Фомкин, Маргарет Макмиллан, Том Сегев, ведущих специалистов по ближневосточной истории. Некоторые утверждают, что Лоуренс говорил о возможности альянса между евреями и арабами. Другие подчеркивают, что "презрение" Лоуренса к арабам отнюдь не является чем-то необычным – можно вспомнить таких деятелей, которых никак нельзя заподозрить в сионизме, как Нельсон Мандела или Ганди. Есть и те, у кого вызывает раздражение, что евреи ищут поддержки в том, что касается сионизма, "у гомосексуалиста Лоуренса", в то время как им должно быть достаточно Торы.

Некоторая двойственность просматривается в ответах писателя иерусалимской газете. Критичная в отношении арабской культуры, не приспособленной к дипломатии и склонной к инстинктивным реакциям, точка зрения Лоуренса была распространена, по мнению многих ученых, в Великобритании того времени. Но в настоящее время многие убеждены в том, что Лоуренс восхищался смелостью и преданностью арабских повстанцев. Другие путешественники той поры, к примеру Уилфрид Тиесайгер или еще раньше Уильям Гиффорд Полгрейв, изучали арабскую культуру и распространяли восхищение ею в Соединенном Королевстве. Единственным литератором, который не разделял этого восхищения, был Чарльз Доти, автор "Пустынной Аравии", к которой Лоуренс написал предисловие, где попытался убедить читателя, что автор все же любит Аравию. Не слишком точным кажется термин "statehood" – "государственность", а не "государство" – его Гилберт использовал для обозначения еврейской общности, которая должна "оберегать" арабов. В действительности, говорят ученые, в Великобритании, которая входила в состав Совета Лиги Наций, никто не думал о таком государстве, как Израиль.
http://www.inopressa.ru/repubblica/2007/02/23/13:27:06/lourens


Прямо по Чехову
- Monday, February 26, 2007 at 00:32:00 (PST)


Причиной крушения поезда в британском графстве Камбрия могло стать плохое техническое обслуживание путей, сообщает The Guardian. По данным издания, предварительное расследование показало, что на стрелках, расположенных на участке пути, где произошла авария, отсутствовали гайки. По информации источника, они лежали рядом рядом с теми конструкциями, к которым должны были крепиться.
...
Напомним, что пассажирский поезд, следовавший из Лондона в Глазго, сошел с рельсов и перевернулся вечером 24 февраля. В результате одна женщина погибла, пять пассажиров получили серьезные травмы. По данным The Guardian, в настоящее время их жизнь находится вне опасности.


Ривка Лазаревич
- Monday, February 26, 2007 at 00:23:03 (PST)

Омен-Таши Бабы Эстер

http://world.lib.ru/a/antipartijnaja_g_t/070226_rivka_omentash.shtml

Мы тут с Товарищами посоветовались, и мне разрешено раскрыть некую тайну. А именно - кое-кто из нас не только Товарищи по Антипартийной Группе, но и родственники. А конкретно - Реувен и Аврум - мои двоюродные братья. У всех нас была общая бабушка по имени Эстер Тарантул, баба Фира.
Почему я вдруг вспомнила о ней сегодня? Пурим на носу, вот почему.
Я, кстати, энное количество лет назад поселилась в Иерусалиме именно в день празднования Пурима. Первое впечатление от будущего родного города - по улицам фланируют вполне взрослые тетки, по маскарадному нагримированные. С закрученными гусарскими усами, например, лихо наведенными тушью на щеках... А уж про детей и юношество и говорить нечего! Этакий спокойный, незаорганизованный, почти обыденный карнавал... И вот уже сколько лет собираюсь тоже вот так намазаться и явиться разрисованной на работу, да никак не решусь, а годы уходят, все лучшие годы!
Тогда кто-то меня научил, что в этот день положено одаривать соседей пуримской выпечкой "озней Аман" - "ушами Амана" - пирожками со сладкой начинкой. Купила я в супере кило и занесла несколько штучек соседке, тоже русскоязычной новой олимке, Юле-художнице, что жила этажом ниже... Но если честно, то мне эти покупные "озней Аман" не понравились, где им до бабы-фириных "омен-ташей"!
Бабушка обязательно пекла их каждый год к Пуриму. Треугольные, из сдобного теста, двух сортов. Один был с маком, а другой она начиняла сложной смесью из молотых орехов, кураги, с примесью варенья для связки. А я, бабушкина помощница, любила смешивать эту начинку и все время пробовала. И брат Рувка как-то так и заснял меня с ложкой в руке и перемазанной мордашкой...
И бабушка устраивала для нас, внуков, праздник с чаепитием и игрой в "Царицу Эстер". Царицей у нас была, конечно, я, впервые - года в три. А вот, старшим - Абраше и Рувке, приходилось отрабатывать по нескольку мужских ролей, а также роль строптивой царицы Вашти, за которую они, честно говоря, иногда дрались. Ну что интересного в ролях Мордехая или царя Ахашвероша? У Амана, там еще есть, что сыграть - злодеи, они завсегда сценичнее. А если тебе досталась роль евнуха, что тогда? И мои старшие кузены-ровесники всегда долго выясняли, кому играть этих недоделанных. В свои десять-двенадцать лет они уже хорошо разбирались, кто это такие...
Так вот, сидим за столом, едим омен-таши, пьем чай, а бабушка, как всегда, улыбаясь, начинает наш застольный Пуримшпиль:
- Меня назвали Эстер по моей бабушке, а ее - по ее бабушке, а ту - по ее... И так вот тянется эта цепочка в далекие годы, в город Шушан, где тогда жили евреи, потому что их выгнали из Земли Израиля и увели в плен. Весь наш народ увели. И прожили они в том плену много лет, и уже не одно поколение успело там родиться, и многие забыли про свою родину, про Израиль. И стали они походить на другие народы... И вот жил в Шушане еврей по имени Мардехай, названный по имени халдейского бога Мардука и была у него приемная дочь, сирота, а по родству - двоюродная сестра его, по имени Эстер, названная так по имени местной богини Иштар, девушка красивая, грамотная и послушная. На одни пятерки училась. Умница! И брат, ее удочеривший, всегда и во всем с ней советовался. Сядет вечерком, придя с работы, и спрашивает: "А скажи-ка, Эстер-швестер (сестричка, значит), как, ты считаешь, я должен поступить?" Ну, скажем, корову купить или водопровод в дом провести. Или еще что-нибудь. А она ему все скажет, как надо, и все у него ладилось, и богател он, и стал одним из самых богатых людей в городе.
-- Ну-ка, Рувонька, ты у нас сегодня будешь Мардехаем.
-- А царем в это время был Ахашверош. Он, когда стал царем, то получил в наследство семь стран, а потом завоевал еще 20, а потом еще 100(*)! И была у него огромная империя, множество дворцов, и в каждом дворце - отдельная жена и множество прислуги. Так тогда было принято - мужчины умели свои семьи прокормить. Это не то, что сейчас - мои Малкале и Суреле вынуждены каждый день ходить на работу. А тогда - женщины не работали - только по дому, да с детишками. Муж сам все в дом доставал. Ну, а уж если он - царь...
-- Ну а ты, Авреймел, сегодня ты у нас царь Ахашверош!
-- Нет, бабушка, я в прошлом году был Ахашверошем, а сейчас я хочу быть царицей Вашти. Не могу же я сразу быть и мужем, и женой!
-- Почему? Будь.
-- Нет, - кричит Рувка. - Так не пойдет, я буду Вашти!
-- Я сказала - Авреймел! - отрезает бабушка, а с главрежами не спорят, и брату ничего не остается, как приняться за следующий омен-таш.
- Так вот, когда Ахашверош присоединил сто двадцать седьмое по счету царство, он решил устроить праздник победы с большой пьянкой. И весь народ позвал. Ну, не весь конечно, но людей знатных и богатых от всех сословий и народов, что были в его империи. И евреев тоже. И пьянка-гулянка шла у них полгода без просыпу. А после всего этого Ахашверош на неделю устроил у себя пир для всего-всего населения столицы своей, города-героя Шушана, и все там веселились. И подавали им еду и питье на трофейной посуде, и приносили вино в священных еврейских сосудах, украденных из Иерусалимского Храма царем Набом, фашистским захватчиком... Но все веселились, даже евреи, ибо все боялись царя.
- Авреймел, ты бы не на омен-таши налегал, а изображал бы царя Ахашвероша, а ты, Рувик - гостя.
И "наливает" царь Абраша гостю Рувику из кулака в кулак, и "выпивает" тот за его здоровье.
- А в это время на женской половине дворца веселились женщины во главе с царицей Вашти, главной женой. А выпивший царь захотел похвастать перед гостями ее красотой и послал за нею. А она слуг прогнала, сказала, что ей весело в ее компании, и никуда она не пойдет. Царь осерчал. Он не привык, чтобы ему перечили, и посоветовавшись с вельможами, решил отстранить строптивую Вашти от места главной жены и изгнал ее, и издал указ по всей империи, что каждый муж в своем доме - хозяин, а женщины только повиноваться мужьям должны. Конечно, в то время женщины же не работали...
-- Ну, киндерлах, давайте!
И мы все, смеясь, скачем в каких-то половецких плясках на пиру Вашти. Абрашка, прижав кулаки к груди, виляя задом и кривляясь, изображает Вашти, а затем меняет роль и, подбоченясь и насупив брови, показывает гнев царя, и снова, схватившись в ужасе за голову, возвращается в образ царицы. А "гость" Рувик недоуменно крутит головой...
- Ну, и решил царь взять себе новую царицу вместо Вашти. И привели к нему многих девушек, и Эстер среди них. И приглянулась она при дворе, и дали ей семь служанок, и все, что нужно для царевой невесты, и оставили во дворце. А брат ее Мардехай приказал ей никому не рассказывать, что она еврейка. А она девушка была скромная, ей и одной служанки много было, и потому она шестерых отпускала и оставалась каждый день с одной только. А когда наступала суббота - день для евреев особый, Эстер зажигала свечи, молилась нашему Богу, но у нее по субботам дежурила одна и та же служанка, и та не могла отличить, чем этот день отличается для госпожи от дней остальных, потому что видела госпожу только по субботам, а другие служанки, - те только в обычные дни, и они не могли опознать в ней еврейку и выдать. И вот так готовили Эстер к замужеству с царем несколько месяцев, и он выбрал ее из многих, полюбил, и стала она главной его царицей.
-- Ну, давай, Ривкале. Теперь твоя очередь.
И я подбегаю к зеркалу, кривляюсь возле него, изображаю, будто крашу губы и пудрюсь, как мама...
-- А Мардехай в это время ходил под забором дворца и все хотел узнать, а как там поживает его Эстер-швестер...
-- Ну, Рувик!
И Рувка ходит туда-сюда, жуя очередной омен-таш и закатывает глаза, как бы пытаясь заглянуть за высокий забор.
- И вот однажды сидел он под забором, а мимо шли двое царских евнухов, и услышал он случайно их разговор. А говорили они, что хотят царя отравить. И Мардехай тут же передал об этом царице, своей Эстер-швестер, а она - царю, и заговорщиков казнили.
И тут братья мои, отчаянно жестикулируя, разыгрывают сложную и крайне невразумительную пантомиму, одновременно играя и Мардехая, и евнухов, и царя, и палачей, и казненных. А я ношусь между ними. И Рувка шепчет мне что-то на ушко, а я - Абрашке... А в руках, конечно - омен-таши!
- А после этого царь назначил главным своим вельможей Амана, чужеземца и приказал всей империи оказывать ему уважение. А этот Аман был фашист, настоящий Гитлер! Но все его боялись, и когда он проезжал по улице все кланялись ему, а некоторые даже падали лицом вниз. Лишь один Мардехай, который все дежурил у царских ворот, не склонял головы. Однажды амановы слуги подъехали к нему и спросили: "А почему ты не склоняешься перед великим Аманом"? А он им говорит: "Я - Мардехай-иудей! Мы иудеи - народ жестковыйный, у нас шея жесткая, негнущаяся!". "Ну, так мы ее тебе свернем!" - пригрозили слуги и ускакали донести Аману. А он разозлился, озверел и решил уничтожить всех евреев, фашизюка такая! И пошел к царю, нажаловался на евреев, а тот, придурок, сразу дал Аману власть сделать с евреями, что ему захочется. И объявили об этом по всей стране...
И опять пантомима. Братья с хохотом гримасничают, кривляются, изображая жаркие страсти. А омен-ташей на вазочке уже совсем мало, бабушка приносит с кухни новые и чай доливает.
- И испугались евреи, женщины рыдают "Гволд!", мужчины объявляют голодовку в знак протеста, но кому до нас есть дело? Вон, когда Гитлер убивал, то кто вступился? Даже помогали ему... Или малхамувэс усатый собирался всех нас в Сибири заморозить?.. Ну так вот, держит Мардехай голодовку перед царскими воротами, а Эстер-швестер его из окна увидала и послала слугу узнать, в чем дело? Ну, Мардехай ему: "Так, мол, и так. Вот, что Аман затеял против нас!". И дает слуге бумажку с указом, чтобы тот показал его Эстер...
Я залезаю на стул и из-под ладошки козырьком смотрю, как Рувка ложится на пол, а Абраша изображает вопросы, чертя в воздухе рукой вопросительные знаки. Рувка же жестикуляцией - ребро ладони по горлу - разъясняет ему замысел аманов. Потом Абраша подает мне из рук в руки невидимую бумажку.
- Прочитала Эстер указ и закричала: "Вэй из мир! Вус тиен? Я же не могу к нему пойти! Он меня убьет! Этот самодур Ахашверош никого не пускает к себе без разрешения! Я уже его целый месяц не видела. Тоже мне муж! Лучше бы я за сапожника вышла!"...
И я "рву на себе волосы" и воздеваю руки к небу...
- И послала она слугу к Мардехаю и приказала ему собрать всех евреев в городе и три дня поститься, и сама со служанками три дня постилась. А после этого надела самую богатую царскую одежду и встала во дворе перед царским окном. Ее корона так ярко сверкала на солнце, что царь подошел к окну, восхитился Эстер и позвал ее.
Теперь Абрашка влезает на стул и оттуда манит меня пальчиком.
- И говорит ей Ахашверош: "Что ты хочешь? Полцарства?" - "Да нет, - отвечает Эстер, просто соскучилась и хочу пир завтра устроить. Кнышиклах нажарю, гефилте фиш сготовлю, шейку утиную с гречневой кашей. Приходи с Аманом, посидим, повеселимся. Я вам спою".
И мы с братом продолжаем пантомиму: он разводит руками, я тоже жестикулирую, периодически прикладывая руку к сердцу, что означает мою горячую супружескую любовь.
- И пришли царь с Аманом, и ели и пили, и были довольны очень, и пригласила их Эстер прийти и на следующий день. А во второй раз стол был у нее такой, что там не хватало только салата из гильдерне зэйгерлах! И они опять ели и пили, и были очень довольны, и царь опять спросил ее: "Ну, что же ты хочешь?". А она опять их приглашает прийти, уже в третий раз - вот тогда, мол, скажу. И вышел Аман, а у ворот Мардехай лежит, все еще голодовку держит. И не только сделал вид, что Амана не замечает, но даже, говорят, плюнул ему вслед.
Изображаем и эту мизансцену. Особенно удачно получается неканонический плевок.
- Аман обозлился очень, однако смолчал. А домой пришел, пьяный с царского угощения, и стал хвастаться, какой он великий, мол, из всех придворных только его царица приглашает на пиры. "Но только, - говорит, - эта жидовская морда Мардехай у царских ворот постоянно торчит и меня раздражает". А жена ему и советует: "Будешь завтра у царя, скажи ему, чтобы повесили этого жида Мардехая на самом высоком дереве". И понравился ее совет Аману.
На этот раз и я беру вторую роль - жены Амана. Оскаливаюсь, делаю "страшное лицо".
- А у царя с перепоя болела голова, а от обжорства - живот, и он не мог заснуть и приказал писцу читать последние известия. Ну, тогда радио не было, а просто записывали в книгу все события, а когда надо - читали. И вот читает ему писец про то, что Мардехай помог раскрыть заговор против царя. "И как мы его наградили?" - спросил царь. "Да пока - никак, - говорит писец, здесь ничего не записано". - "Позвать Амана!" - приказал царь. А Аман и сам ждал приема, хотел получить указ, чтобы повесить Мардехая. Входит он к царю, а тот и спрашивает: "Как бы ты на моем месте отблагодарил самого верного моего слугу?". Аман решил, что это о нем самом и говорит: "Ну, одел бы в царское платье, посадил на царского коня и с почетом провел по городу". - "Хорошо, - говорит царь. - Тогда сделай то, что ты сейчас сказал, с тем евреем Мардехаем, что сидит у ворот!".
Омен-таши в меня уже не лезут. Только попиваю чай, но игра, с непрерывным нашим хохотом, продолжается. А бабушка рассказывает:
- Ну, Аману деваться некуда. Приказ начальника - закон для подчиненных! С тоскою душевной взял он царского коня и одежду, вышел на улицу, надел все это на Мардехая, усадил его на коня и повел под уздцы, выкрикивая: "Вот человек, которого наш царь наградил! Почет ему и уважение!".
И тут я становлюсь Аманом, а Абрашка - конем, он встает на четвереньки, Рувка взбирается на него верхом, а я - Аман веду "коня".
- И пришел Аман домой расстроенный, а жена его и советники все в один голос: "Не надо связываться с этим евреем Мардехаем, все равно его тебе не одолеть!". А тут и время пришло идти на третий седер пира Эстер. Ну, и опять царь стал ее спрашивать, чего же она от него хочет. А она ему и говорит: "Подари мне жизнь мою и народ мой, ибо именем твоим нас хотят уничтожить!" - "Так кто же этот злодей?" - вопрошает царь. - "Да вот, он", - отвечает царица и - пальцем прямо на Амана! Тот сразу струсил, заплакал, пощады стал просить, но ничего не помогло. Прибежала стража, и его сразу повесили на высоком дереве, что он приготовил для Мардехая...
На высоком эмоциональном накале исполняем кульминационную сцену.
- Вот так и Сталин хотел евреев убить, но Бога не перехитришь, остановил он злодея. Как раз в Пурим остановил! Ты, Ривочка тогда только родилась, не помнишь! Ну, а царь Ахашверош возвысил Мардехая и стал он у него главным вельможей. И отменили указ об уничтожении евреев. И, наоборот, через Мардехая царь издал указ о том, что евреи могут защищаться от погромщиков и убивать их. И побили наши тогда немало погромщиков. И в память этого мы и празднуем Пурим. Это наш еврейский День Свободы и Победы...
... Ох, эти галутные еврейские мечты о чудесном спасении, на протяжении веков иногда становившиеся явью!
... Ох, бабушка Эстер! Эстер-швестер, благословенна твоя память!
... А сегодня, в преддверии Пурима, на "9-м канале" израильских детей учили зажигать... ханукальные свечи. Как не хватает им настоящей еврейской бабушки!

Иерусалим 25.02.07


-- Примечание редактора "7 канала":
Этот "факт", как и некоторые другие в повести бабушки, отнюдь не исторический. Ахашверош унаследовал всю или почти всю империю от своего тестя. А сам в основном был горазд на сборы дани и пьянки.

Первая публикация на сайте "7 канал"
http://sedmoycanal.com/article.php3?id=222885



Игрек
- Sunday, February 25, 2007 at 23:14:21 (PST)

АК

Вряд ли это уже имеет значение для Вашей статьи, но в книге Paul Johnson "A History of the Jews", книге весьма тщательно и аргументировано написаной, сказано, что "исход произошел в 13 столетии и был закончен около 1225 года". Там же сказано, что не все братья (колена) ушли в Египет (теория весьма известная). Несколько братьев (колен, конечно), от 4 до 6, провели все время "египетского пленения" в землях хаананских. Не знаю, вносит ли этот возможных факт некоторую "помеху" в Вашу торию дальнейшего распространения гаплотипа Иакова по планете.


Ontario14
- Sunday, February 25, 2007 at 20:20:49 (PST)

Буквоед - Ontario14
- Wednesday, February 21, 2007 at 05:03:48 (PST)
Реквием по русскому языку
---
Классический пример асемитизма, как Вы думаете?

************

Не думаю. Грех жаловаться специалистам по русскому языку в Израиле. Посчитайте сколько ежедневных русских газет выходит - чуть ли не больше, чем чем ивритских и арабских. На идиш вон уже ни одной не осталось ...
Как и на польском, румынском, венгерском. Результат настоящей, а не надуманной политики изведения этих языков в Израиле на корню.

А русский язык - сложный и странно звучащий. Ну не аттрактивен он для детей, как французский или испанский. Даже арабский более музыкален, чем русский.
И прожить без Достоевского можно. И нужно. Это мне так... каэтцца.
Самое смешное, что написал всё это я,- человек заставляющий своих детей учить русский и иврит :-)))




AK
Boston, MA - Sunday, February 25, 2007 at 17:07:10 (PST)

Уважаемый коллеги,

Поскольку в сегодняшней дискуссии упомянута будущая статья о поисках пропавших колен, то во избежание недоразумений должен сказать, что статья уже сегодняшняя (в ее первой части из нескольких). Но ее несколько развернутая версия будет вот-вот представлена в "Заметки", или куда уважаемый Редактор определит. Ниже - строки из будущего предисловия:

Я опубликовал это расследование совсем недавно в другом независимом издании, но решил развернуть повествование в несколько другом ракурсе для читателей «Заметок по еврейской истории». Для этой аудитории, в большей степени интересующейся еврейской историей, чем средний русскоязычный читатель, я дал больше сведений о том, что может представиться всего лишь деталями для аудитории в России. Например, ДНК-генеалогические различия между ашкеназами и сефардами, и более детальные описания ДНК-гаплотипов. В остальном материалы похожи.




Авигдор
- Sunday, February 25, 2007 at 16:43:59 (PST)

М.Тартаковский.
- Sunday, February 25, 2007 at 14:25:01 (PST)
Не значит ли это, что мы попросту глупы? ===

Мсье Тартаковский, именно об этом вам постоянно и говорят.


Гитлер по сходной цене
- Sunday, February 25, 2007 at 16:40:50 (PST)

www.pravda.ru/culture/literature/22-02-2007/214137-gitler-0


Самуил
- Sunday, February 25, 2007 at 16:36:34 (PST)

Фдуч
- Sunday, February 25, 2007 at 14:14:01
Уважаемый, мне не надо никому ничего доказывать... Мне только показалось, что несолидно для профессора с мировым именем брать данные для иследования на эмигрантском сайте, а не в ближайшей синагоге


Пока я писал в перерывах работы, профессор сам ответил, так что большую часть своего ответа я за ненадобностью вычеркиваю. Не поверите, но писал в точности о том же: здесь не данные берутся, а идет обкатка будущей статьи на референтной группе - заинтересованных, доброжелательных, далеко не глупых, эрудированных читателях, среди которых, к тому же, немало знатоков гебраистики (в коей сам автор далеко не специалист). Очень мудрое решение...

Меня, признаться, тоже слегка резанул этот эмигрантский сайт. Если оценить беспристрастно круг пишущих здесь авторов - в какой ближайшей синагоге, на какой кафедре Вы отыщите такое созвездие совершенно замечательных ученых, музыкантов, литераторов и просто - умных людей. А если учесть, что практически каждый, вполне дюжинный, человек, в какой-то своей, пусть узкой, области - специалист (даже такой "выдающийся мыслитель", как Ваш покорный слуга), то получается, что на этом эмигрантском сайте можно в порядке развлечения получить столько познаний, сколько не добудешь за долгие дни напряженного труда. Но это при условии, что собеседники доброжелательно и вежливо общаются, а не гавкаются (свара затягивает и удивительным образом оглупляет даже умнейших).

Вот потому-то мне неприятно и обидно видеть перебранки "не по делу" в нашей гостевой. Это настолько досадные, дурацкие помехи, что... Ну ладно, я - рядовой гость. Но наш гостеприимный хозяин того же мнения: "вам нужны великие потрясения, а мне... нормальный интеллигентный журнал и гостевая при нем". Надеюсь, что так и будет.


Евгений Беркович
- Sunday, February 25, 2007 at 14:55:46 (PST)

М.Тартаковский.
- Sunday, February 25, 2007 at 14:25:01 (PST)
Уважаемый Евгений Михайлович!
Интеллигентный не значит - стерильный. Скорее, наоборот


Уважаемый Марк, грязь здесь не допускается. Все, что Вы хотите сказать, можно сказать без грубостей. Мнения могут быть разными, форма тоже, но в рамках допустимого. Это правило здесь незыблемо. Это не значит, что мы не публикуем спорных статей и даже тех, с которыми редакция не согласна. На Ученом совете можно отстаивать разные позиции, но нельзя материться и плевать на пол.

Помощник Модаратора - Alex'у
- Sunday, February 25, 2007 at 14:21:41 (PST)
Я запросил рарешения Евгения уничтожать Ваши грубые постинги. Это разрешение почти наверняка будет получено. Превращения этого места в гуся не будет.


Я Вам ответил, но comcast блокирует почту. Да, конечно, грязь и личные оскорбления надо стирать без предупреждения.

Помните наш девиз:

Пожалуйста, воздерживайтесь от высказываний, могущих оскорбить других людей!
Лучший способ защиты - не уподобляться!


Спасибо за понимание!


РГ
- Sunday, February 25, 2007 at 14:50:08 (PST)

Фдуч
- Sunday, February 25, 2007 at 14:14:01 (PST)
Мне только показалось, что несолидно для профессора с мировым именем брать данные для иследования на эмигрантском сайте, а не в ближайшей синагоге - если мне не изменяет память, на 29й в Бостоне, что соединяет 95 с 93, недалеко от Гарварда аккурат находится синагога..;-)


Как-то всегда было принято полагать, что претензии к данным начинаются тогда, когда источник данных соминительный.
Почему эмигрантский сайт автоматически предполагается таковым совершенно непонятно.



AK
Boston, MA - Sunday, February 25, 2007 at 14:50:06 (PST)

>Фдуч, Sunday, February 25, 2007 at 14:14:01 (PST)
>Мне только показалось, что несолидно ...брать данные для иследования на эмигрантском сайте, а не в ближайшей синагоге...
######################

Уважаемый Фдуч,

Ваш комментарий меня, признаться, удивил. В нем сквозит некоторое пренебрежение к "эмигрантскому сайту". Я могу ответить несколькими "позициями", но в одной мне придется раскрыть некоторые полупрофессиональные секреты. С нее, "позиции", пожалуй, и начнем.

Я не беру здесь данные для исследования. Я, если угодно, вхожу в контакт с аудиторией. Дело в том, что вскоре в "Заметках" появится моя статья-расследование по поиску пропавших колен Израилевых. Если редакция примет, конечно. И мне надо понять, что от подобной статьи ждет аудитория, "притереться" к языку, терминам, и интересам аудитории. Мне надо, чтобы статья попала в относительно подготовленную аудиторию, в той мере, в какой это возможно. И, читая дискуссии, комментарии здесь по разным вопросам, задавая одни вопросы и отвечая на другие, я многое усвоил и внес в статью немало изменений и корректив. Полагаю, что это разумно. Наконец, общаясь на этом сайте, я получаю немалое удовольствие от контактов. Это, так сказать, бонус.

Наконец, я познакомился здесь всего за месяц с хорошими людьми, они мне присылали свои интересные статьи, и я получил дополнительное удовольствие от чтения. Опять же много нового узнал. А профессиональный математик, выступающий здесь под простеньким ником, прочитал мне - не на этом форуме, а е-мейлами - короткую, но крайне полезную лекцию по теории вероятности и ее конкретным приложениям. Я много помнил, но оказалось, далеко не всё. Это мне помогло для разработки некоторых критериев отбора данных.

Наконец, здесь присутствуют специалисты высочайшего класса по истории иудаизма и его интерпретации, авторы крайне интересных опубликованных статей по этим вопросам.

Поэтому, уважаемый Фдуч, никак не могу согласиться с Вашими словами пренебрежения про "эмигрантский сайт".

И последнее. Данные для моего исследования я никак не мог брать в синагоге. Это - данные по молекулярно-биологическому анализу микросателлитов ДНК людей, живущих в разных странах и на разных континентах. Если Вы мне подскажете адрес синагоги, где проводят соответствующие работы, я буду Вам очень признателен. В Бостоне по указанному Вами адресу это не делают. Зря сходил (шучу). Не беру я эти данные и на этом сайте. Но, уверяю Вас, не потому, что он "эмигрантский". Видимо, есть другие причины.




Игрек
- Sunday, February 25, 2007 at 14:39:58 (PST)

Буквоеду

Автор утверждает, что это совершенно другая книга, повторяющая Вами названную только по форме. Именно потому, что в 70-х он не имел и части сегодняшних документов. Книга сейчас самая читаемая в Испании, где она вышла в несколько другой форме (меньше предистории - там ее знают все). В частности, в предисловии автор особено благодарен некоторым историкам и архивистам в Ленинграде за открытие очень большого количества новых исторических документов "с советской стороны". И одновременно упоминает о совершенно неизвестных документах из архивов Германии и Великобритании.
Что меня поразило в начальных главах и особенно в предистории, так это какое-то мистическое подобие русской и испанской истории. То есть, если вместо слова "Испания" поставить "Россия/СССР, то во многих фразах смысл не изменится вообще.
(У нас тут налетела очень ветренная и дождливая погода, пришлось экстренно отменить закрытие лыжного сезона)



Alex
- Sunday, February 25, 2007 at 14:27:46 (PST)

wow!! Ich scheisse in die Hose vor lauter Wut and Ängstle..:-) Schiess los, Elender..:-))
Aber ich kann auch unter anderen Spitznamen auftreten - hasch due die Möglichkeit auch abgewägt?:-))


М.Тартаковский.
- Sunday, February 25, 2007 at 14:25:01 (PST)


Уважаемый Евгений Михайлович!

Интеллигентный не значит - стерильный. Скорее, наоборот.
Я как-то стесняюсь публиковать на Вашем сайте серьёзные, обоснованные соображения о том, сколько вреда наносит нашему народу принятые в Германии, Австрии, в некоторых других странах уголовные законы против отрицателей Холокоста.
"Скрывают - значит, что-то да не то..."

Неужели у нас нет слов, нет аргументов для ответа?
Неужели мы - "выше этого"?..
Не значит ли это, что мы попросту глупы?

Помпезное кладбище в центре Берлина, на котором никто не похоронен, -не вызывает ли невольно ощущение грандиозного обмана?
Не оскорбительно ли оно для миллионов действительных наших жертв?

Надеюсь, Вы не уничтожите эту мою горькую запись?


Alex
- Sunday, February 25, 2007 at 14:21:56 (PST)

also, tschüss miteinander bis zum letzten Mal - hab' zu tun im Bereich CICS..:-))


Помощник Модаратора - Alex'у
- Sunday, February 25, 2007 at 14:21:41 (PST)

Я запросил рарешения Евгения уничтожать Ваши грубые постинги. Это разрешение почти наверняка будет получено. Превращения этого места в гуся не будет.

Это предупреждение. Вторым шагом будет Ваше забанивание.



Alex
- Sunday, February 25, 2007 at 14:15:05 (PST)

das war natürlich Alex..:-)


Фдуч
- Sunday, February 25, 2007 at 14:14:01 (PST)

Самуил, я выступил только по поводу трусливого урода. Мне не хочется повторять, по какому именно поводу.
Уважаемый, мне не надо никому ничего доказывать - у профессора А.Клесова своя жизнь, у меня своя. По крайней мере, мне за свое положение не стыдно - работаю и вроде неплохо. Денег всегда хочется больше, с этим спорить не буду.;-)
Мне только показалось, что несолидно для профессора с мировым именем брать данные для иследования на эмигрантском сайте, а не в ближайшей синагоге - если мне не изменяет память, на 29й в Бостоне, что соединяет 95 с 93, недалеко от Гарварда аккурат находится синагога..;-)

Я direkt, как говорят немцы..;-)


Тартаковский.
- Sunday, February 25, 2007 at 14:11:06 (PST)


Alex
- Sunday, February 25, 2007 at 07:55:00 (PST)

Есаул, именно я..;-) Что делать, если у меня богатая биография!?............
>>>>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<

Мне очень приятно узнать, что у Вас "богатая биография", что Вы "до сих пор балдеете, слушая исполнение 5-го концерта Бетховена", что Вы, словом, "не так прост", как может показаться.
Я Вас поздравляю.


Евгений Беркович
- Sunday, February 25, 2007 at 13:51:26 (PST)

- Тартаковский.
- Sunday, February 25, 2007 at 13:21:13 (PST)

Уважаемый Евгений Михайлович!

При просмотре гостиной в субботу и воскресенье мне показалось, что Вы раза два снимали тексты анонимного Алекса. Вы знаете /я уже не раз обращался к Вам с подобными просьбами - и Вы, мне показалось, прислушались к ним/, что я решительно против такой практики. Полная стерильность - худшая профилактика. Некоторые авторы мне представляются загадкой. Этот Алекс весь здесь - как на ладони. Это ли не поучительно? И не для меня одного.
С почтением.
Тартаковский.


Уважаемый Марк, я знаю Вашу просьбу, но при всем уважении не могу ее выполнить. Как сказано по другому поводу, вам нужны великие потрясения, а мне... нормальный интеллигентный журнал и гостевая при нем. Поэтому грязные надписи, при всей их поучительности, будут стираться. А те, кто упорствует во грехе злословия, будут выводиться из гостевой. Таковы здешние правила, и с ними нужно либо смириться, либо искать другую гостевую. Что сейчас, слава Б-гу, не трудно.
Удачи!


Тартаковский.
- Sunday, February 25, 2007 at 13:50:33 (PST)


Самуил
- Sunday, February 25, 2007 at 13:21:15 (PST)

Здесь дискутируют на всякие (кому что интересно) темы и приводят ссылки на примечательные (по их мнению) публикации. Все! Точка! Кто страдает от фрустраций - извольте в соответствующее лечебное заведение или на сайт типа Гусьбуки. Но, пожалуйста, - не сюда!

>>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<<

Вот против такой Вашей позиции я решительно возражаю.
Кто станет определять, страдает ли автор "фрустрацией" /кстати, что это такое?/ - Вы, я? А вдруг сами мы подвержены худшему, чем эти "фрустрации".
"Пусть расцветает сто цветов!" - я обеими руками - за!
Не нравится - надо уметь ответить, по крайней мере - уметь
выслушать и понять.
Ещё раз: В ПОДОБНОЙ защите я не нуждаюсь. Она оскорбительна. Вы встречались со мной, видели глаза в глаза?
Вам не по душе написанное мной? Не можете толком возразить? Игнорируйте - вот и всё.
Матроскин вот, оказывается, игнорирует. Я ужасно страдаю. Но переживу.



Кремлевский террариум единомышленников и проблема-2008
- Sunday, February 25, 2007 at 13:36:14 (PST)

"Путин еще сам не знает, кто будет преемником, - продолжил политолог, - и мы знаем, что Владимир Владимирович любит откладывать важнейшие государственные решения, не беря на себя за них ответственность. Это значит, что он хотел бы, чтобы преемника избрала сама история, и имя преемника мы узнаем не раньше сентября, а, может быть, даже и в декабре по итогам парламентских выборов".

Согласно представлениям Белковского, философия путинской системы "это философия организованной преступной группировки. Подобно тому, как солнцевская ОПГ управляет городом Солнцево, ореховская ОПГ управляет Ореховым-Борисовым и другие, так и путинская властная машина управляет территорией под названием Российская Федерация".

Ключевая фигура кремлевской ОПГ, по мнению политолога, - Роман Абрамович. Белковский говорит: "Абрамович - это человек, который поставил Путина на тот пост, который Владимир Владимирович сейчас занимает, добившись в свое время замены Николая Аксененко как приоритетного преемника Бориса Ельцина на Владимира Путина. ... Сначала премьером назначили Сергея Степашина, а первым вице-премьером Аксененко. Но тогда вопрос о преемнике еще не был решен. Он был решен в августе. В тот момент 9 августа 1999 года, когда Борис Ельцин назначил исполняющим обязанности председателя правительства и первым заместителем председателя правительства Владимира Владимировича Путина, в принятии этого решения решающую роль сыграл Роман Абрамович, который, конечно, не ошибся ни единой секунды, будучи выдающимся психологом. В тот момент, когда меняли Степашина на Путина, опять возникла кандидатура покойного Аксененко. Но психологически Абрамович понял, что защитить и гарантировать интересы ельцинской «семьи» и его лично может только человек, который не любит власти и боится ее, и поэтому будет гарантом системы, но единоличным правителем.

Безошибочность выбора Абрамовича была связана с тем, что Путин не властитель, он системный человек, он человек, который выполняет все свои обязательства, он их выполнил, он не нарушил ни одного обязательства, он строго действовал в русле тех обязательств, которые взял на себя перед Абрамовичем, перед «семьей» Бориса Ельцина. Путин выгнал из страны тех людей, которые не устраивали «семью» Ельцина, а именно Гусинского и Березовского, он организовал атаку на Ходорковского только потому, что Ходорковский сам первый нарушил системные правила игры, он не атаковал никого, кто не нарушал этих правил и сам не нарушал правил первым, он вручил Борису Ельцину орден «За заслуги перед Отечеством» I степени, хотя с политической точки зрения ему гораздо легче и удобней было отмежеваться от Бориса Ельцина. Путин выполнил все, на что рассчитывал Абрамович и «семья» Бориса Ельцина и в этом смысле нынешнего президента России ни в чем не упрекнешь, а Абрамовича никак не заподозришь в отсутствии прозорливости".

http://www.lenty.ru/gobest.html?http://lenty.ru/cgi-bin/gop.cgi?http://forum.msk.ru/material/politic/20308.html?0534


Маркс ТАРТАКОВСКИЙ.
- Sunday, February 25, 2007 at 13:31:47 (PST)

Самуил
- Sunday, February 25, 2007 at 13:21:15 (PST)

Alex
- Sunday, February 25, 2007 at 10:16:36
Ни профессии, ни языка, ни интеллекта... социальщик с гонором.

Должен заметить, что человек, на которого Вы наскакиваете (и явно провоцируете), это, прежде всего, - пожилой человек....

>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<

Ув. Самуил, простите, но я не нуждаюсь в такой защите. Более того - она оскорбительнее выпадов матроскиных и алексов, к которым я отношусь вполне снисходительно. Время от времени даже подогреваю подобный любопытный интерес к себе. Иногда именно этого и нехватает для полноты жизни. Я "по жизни" - натуралист.
Это Ваше послание как-то проскочило на мгновение раньше моего обращения к г-ну Берковичу /посмотрите по секундам/. Прочтите оное - поймёте мою позицию.
Честь имею!


Verdict
- Sunday, February 25, 2007 at 13:24:27 (PST)

Испанскому королю в загоне, интересующемуся ГДЕ ПРО ЧАВЕСА???!!!

CITGO=Чавес=PETRO EXPRESS. Ручки путают.


Самуил
- Sunday, February 25, 2007 at 13:21:15 (PST)

Alex
- Sunday, February 25, 2007 at 10:16:36
Ни профессии, ни языка, ни интеллекта... социальщик с гонором.


Должен заметить, что человек, на которого Вы наскакиваете (и явно провоцируете), это, прежде всего, - пожилой человек. Старше Вас лет на ...дцать. Не испытываете почтения-уважения? Так - проще простого - не общайтесь. Всего делов-то!.. Ну, какую цель Вы, право, преследуете, тыча в глаза старику его прегрешения (мнимые или действительные - не суть важно)? Воспитательную? Считаете, что человек на восьмом десятке от каких-то слов изменится? Ну уж нет, не идиот же Вы, в самом деле. Тогда какую? А вот такую - (прошу прощения за нелицеприятность) злую, низкую, подловатую: покуражиться над тем, кто заведомо (уже в силу возраста) слабее и беднее, по контрасту ощутить себя важной, социально значимой персоной. А давайте-ка с профессором Клесовым померяйтесь по части профессиональных достижений, интеллекта, социального статуса, званий, степеней, регалий, достатка, наконец. Как говориться, прочувствуйте разницу! Или (Вы, вроде, музыку любите) подумайте над тем, что никогда (Никогда! Никогда до конца дней Ваших - живите до 120) не сможете Вы сыграть бетховенские сонаты так, как их играет г-н Избицер... Однако, это вовсе не повод срывать злость на г-не Тартаковском. Короче говоря,

"Холоднокровней, Маня, Вы не на работе!"

Увы, порой наша гостевая начинает напоминать пресловутую Гусьбуку. Там душевно ущербные люди "меряются пузами" и "выпускают пар" (с остервенением ругаются друг с другом). Здесь же дискутируют на всякие (кому что интересно) темы и приводят ссылки на примечательные (по их мнению) публикации. Все! Точка! Кто страдает от фрустраций - извольте в соответствующее лечебное заведение или на сайт типа Гусьбуки. Но, пожалуйста, - не сюда!


РЕДАКТОРУ - Тартаковский.
- Sunday, February 25, 2007 at 13:21:13 (PST)


Alex
- Sunday, February 25, 2007 at 10:16:36 (PST)

Tartakowski, у Вас какой разряд по плаванию - 1-й юношеский есть?.............. Как насчет путешнствий по памиру - как проехать из Чигирчика в Алайскую долину?..

>>>>>>>>>>>>>>>>>>>>>VCT<<<<<<<<<<<<<<<<<<<<<<<

Уважаемый Евгений Михайлович!

При просмотре гостиной в субботу и воскресенье мне показалось, что Вы раза два снимали тексты анонимного Алекса. Вы знаете /я уже не раз обращался к Вам с подобными просьбами - и Вы, мне показалось, прислушались к ним/, что я решительно против такой практики. Полная стерильность - худшая профилактика. Некоторые авторы мне представляются загадкой. Этот Алекс весь здесь - как на ладони. Это ли не поучительно? И не для меня одного.
С почтением.
Тартаковский.



Гусинский стал испанцем
- Sunday, February 25, 2007 at 13:08:44 (PST)

Испанское правительство предоставило гражданство бывшему российскому медиамагнату Владимиру Гусинскому

Автор фото: Михаил Ковалёв
Как сообщает издание “Мундо”, гражданство олигарху было предоставлено решением совета министров Испании еще 9 февраля, однако факт его предоставления не разглашался и пока не был опубликован в официальном государственном бюллетене. Испанская газета отмечает, что Гусинский располагал ранее гражданством Израиля, а получив испанское, сможет беспрепятственно находиться в любой стране Евросоюза. По данным издания, “Гусинский сделал первую попытку получить испанское гражданство еще в 1996 году, заявив, что его мама — потомок евреев-сефардов, некогда населявших Иберийский полуостров и изгнанных отсюда в конце XV столетия”. Теперь Гусинского нельзя будет экстрадировать в Россию, поскольку испанское законодательство не предусматривает экстрадицию своих граждан.




Тартаковский.
- Sunday, February 25, 2007 at 13:02:48 (PST)


Матроскин
- Sunday, February 25, 2007 at 12:12:42 (PST)

М.Тартаковский.
- Sunday, February 25, 2007 at 05:09:00 (PST)
= = = = = =

Тартаковский, НУ НЕ ЧИТАЮ Я ПИСАНИНУ ТАКИХ, КАК ТЫ! Хоть это ты в состоянии понять?

>>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<<

Истерика Матроскина имеет под собой, видимо, какие-то основания, но я не могу понять, какие. Чтобы ЕМУ я предлагал читать что-то мной опубликованное?.. Кому? Зачем?
В это воскресенье я был относительно свободен и заглядывал в гостевую. Матроскин к моему удивлению куда-то исчез. И вдруг - нате вам?.. Впечатление, будто он только что выполз откуда-то из-под кровати...



Д-р Иегуда (Эрнст) Мендельсон
- Sunday, February 25, 2007 at 13:00:57 (PST)

ЕВРЕЙСКИЕ МУДРЕЦЫ
со времен Мишны и до наших дней
Издательство ШВУТ АМИ

Составители: Александр Кац и Цви Вассерман
Переводчик: Александр Кац

Передо мною лежит очень увесистый уникальный том, настолько прекрасно изданный, что трудно поверить, что это наше израильское производство: и печать, и графика, и язык изложения, и оформление страниц, и прекрасные 300 фотографий.
Мы, евреи, оторванные от корней и знания о прошлом и предках, так давно ждали этой работы.

Когда просто листаешь эту энциклопедическую работу, то трудно себе вообразить, что ее могли сделать только два человека, а вернее, один.
Ведь это многолетняя деятельность большого издательского коллектива, а, может быть, и нескольких.
Книгу хочется просто лелеять, как прекрасного новорожденного ребенка, настолько она сделана с душой, четко и ясно, когда по именному указателю в течение считанных секунд можешь найти сведения о наших предках, мудрецах Торы, начиная с первых - создателей Мишны и кончая нашими современниками.

Естественно я бросился искать тех, кого знал, у кого учился.
Огромная заслуга издателей - несколько листов, посвященных Праведнику нашего поколения, нашему общему Учителю, раву Ицхаку Йосефу ЗИЛЬБЕРУ.
В этой статье коротко пройдет весь нелегкий путь Учителя, начиная с его предков, Казань-Ташкент-Израиль, человека, возродившего религиозное "русское" еврейство уже в Эрец Исраэль..
Очень впечатлительна статье о большом Ученом, Любавическом Ребе, где можно почерпнуть много нового о пути этого необыкновенного еврея, создавшего религиозную еврейскую "империю".

Мы только начали учить этот феноменальный труд, именно изучать - иначе к нему невозможно подходить.
Я уверен, что эта книга станет настольным руководством тысяч русскоговорящих евреев, как религиозных, так и пока что далеких от Истоков.
Ее читать и изучать будет необыкновенно интересно ВСЕМ.

Я от всего сердца рекомендую ее всем будущим читателям.

В книге указаны телефоны для связи:
02-5385416 и 02-538 5414

В добрый путь по жизненным путям наших Мудрецов!




Президентом Израиля станет друз
- Sunday, February 25, 2007 at 12:58:45 (PST)


На этой неделе в израильской политической жизни произойдет еще одно беспрецедентное событие: пост президента страны на неделю займет друз - заместитель спикера Далии Ицик Магали Вахаба. Во вторник Ицик, исполняющая обязанности президента, отбывает с официальным визитом в США. Согласно закону Государства Израиль, в этом случае исполнение президентских обязанностей переходит к одному из заместителей председателя Кнессета, являющемуся представителем правящей партии....
http://redirect.subscribe.ru/media.news.online.vestnikisrael,42909/20070225145640/7410=t13=4979/m1910038/-/vestnik.co.il/2007/02/25/druzprez.html


Alex
- Sunday, February 25, 2007 at 12:56:10 (PST)

Парень, я бы на твонм месте был осторожнее - ведь не знаешь, на что можно нарваться, не правда ли!?
Скоро, надеюсь, увидимся..


Редакция

Гостевая книга за февраль (часть 6-я) в архиве


Буквоед - д-ру Дегену
- Sunday, February 25, 2007 at 12:42:50 (PST)

Дорогой Ион Лазаревич! Отец моего друга, Чумак Павел Иванович, получил Героя за то, что в конце войны, командуя своим Т-34, он где-то в Восточной Пруссии уничтожил не то дюжину, не то полтора десятка немецких танков (не помню точное число, но Вы знаете лучше меня за сколько танков могли дать Героя), шедших на прорыв. Исходя из этого, как танкист Вы считаете возможным, что кубанские казаки могли уничтожить 28 немецких танков, тем более, что они, казаки, были в укрытиях, а танки были, судя по дате, были бензиновыми Panzer III, которые легко (относительно) загорались? Спасибо


Испанский король в изгнании
- Sunday, February 25, 2007 at 12:42:17 (PST)

ГДЕ ПРО ЧАВЕСА???!!!!


Буквоед - Игреку
- Sunday, February 25, 2007 at 12:30:22 (PST)

Прошу прощения, что не ответил сразу. Сильно ли новая книга Бивора о гражданской войне в Испании The Battle for Spain: The Spanish Civil War 1936-39 отличается от его же The Spanish Civil War?


Матроскин
- Sunday, February 25, 2007 at 12:12:42 (PST)

М.Тартаковский.
- Sunday, February 25, 2007 at 05:09:00 (PST)
= = = = = =

Тартаковский, НУ НЕ ЧИТАЮ Я ПИСАНИНУ ТАКИХ, КАК ТЫ! Хоть это ты в состоянии понять?


Alex
- Sunday, February 25, 2007 at 10:16:36 (PST)

Tartakowski, у Вас какой разряд по плаванию - 1-й юношеский есть? А насчет своих 'работ' не заикайтесь - в те годы еще и не такую х..йню публиковали, в конце 80хб 90х всякий вздор шел в печать.Хорошо, что Вас не публиковали раньше, в советское время - все-таки понятия о вкусе у редакторов было.
Я , вообще, не понтиаю, что Вы делаете в Германии? Ни профессии, ни языка, ни интеллекта. Для меня Вы такое же чмо, что и Мтроскин . социальщик с гонором. Я давно заметил, что многие эмигранты переписываю себе биографию. Как насчет путешнствий по памиру - как проехать из Чигирчика в Алайскую долину?..


Владимир Вайсберг
- Sunday, February 25, 2007 at 09:56:58 (PST)

АК
Очень рад, что смог хоть чем - нибудь быть Вам полезным и тем самым быть полезным интереснейшим исследованиям Вашим.
Желаю здоровья, счастья и больших творческих успехов!


Alex
- Sunday, February 25, 2007 at 09:53:11 (PST)

Тартаковский, выбирайте выражения для начала!
Я не могу Вам помочь, если Вы невежествны в предмете, о котором рассуждаете! Я бы Вам рекомендовал побольше ходить в библиотеку, а не искать в интернете.Тем более, что Вы не умеете им пользоваться - я набрал, правда, Spiros Marinatos, - и вывалилась х..ва уйма ссылок! Имя и работы Маринатоса это классика в Микенологии, так же как и имя Майкла Вентриса в дешифровке линейного письма А. А о Фестском доске чего слышали? А про сэра Эванса как?
В отличие от Вас, у меня хватает сромности не ссылаться на свои работки типа Историософии и не хвастаться положением бомжа. У Вас хоть какое-то образование есть?


Арабские добровольцы просятся на службу в ЦАХАЛ
- Sunday, February 25, 2007 at 09:51:02 (PST)


Около 150 юношей и девушек из арабского сектора начнут летом службу в ЦАХАЛе. Их уже определили в подразделение следопытов, куда обычно мобилизуют друзов. Арабские девушки будут проходить альтернативную службу, как это принято у представителей религиозного сектора. По выходу в запас они получат все льготы, предоставляемые военнослужащим ЦАХАЛа....

http://vestnik.co.il/2007/02/25/cahalarab.html


Вердикт
- Sunday, February 25, 2007 at 09:46:25 (PST)

Whom It May Concern:
CITGO is now in the process of changing its name to PETRO EXPRESS.
Don't bиy their gas!




~!~
- Sunday, February 25, 2007 at 09:43:33 (PST)

Verdict
- Sunday, February 25, 2007 at 08:00:37 (PST)
А я и молчу.
~!~!~!~!~!~
Когда вещает Муза Тартаковская, даже пушки замолкают, а есаулы перестают рубить капусту и уходят на музыкальный перерыв.


AK
- Sunday, February 25, 2007 at 09:22:29 (PST)

Прошу прощения, следует читать:

то есть разница уже 60 лет - с 153 годами, приведенными Вами.



AK
Boston, MA - Sunday, February 25, 2007 at 09:19:16 (PST)

>Владимир Вайсберг, Sunday, February 25, 2007 at 07:25:25 (PST)
>>АК
>Моисей жил 1432 - 1312 гг. до н. э... Следовательно Исход из Египта состоялся за 40 лет до его кончины - 1312 плюс 40 равно 1352 год до нашей эры.
А Яаков умер в 1505 г. до н. эры, то - есть за 1505 минус 1352 равно 153 года до Исхода евреев из Египта. В ЧЕМ ПРОТИВОРЕЧИЕ?
####################

Уважаемый Владимир,

Никакого противоречия между этими датами нет. Как и с годами жизни Иакова, что Вы приводили ранее - 1652- 1505 до н. э.

Противоречие, о котором я упоминал, вносит датировка извержения Тэрского-Санторинского вулкана 1628-м годом.

Да и дата вручения Торы Моисею (приведенная Альтаиром) как 1400 г до н.э. тоже вносит некоторые противоречия, хотя там настолько круглая дата, что вряд ли претендует на точность. Согласно этой дате, Моисею было 32 года, когда он получил Тору - если, конечно, опираться на даты, показанные Вами.

А Яаков умер в 1505 г. до н. эры, то - есть за 1505 минус 1352 равно 153 года до Исхода евреев из Египта. В ЧЕМ ПРОТИВОРЕЧИЕ? - пишете Вы. Никакого, если не считать того, что Исход из Египта был через 430 лет после вхождения туда ("Времени же, в которое сыны Израилевы обитали в Египте, было четыреста тридцать лет" - Исх. 12:40), то есть через 430-17 = 413 лет после смерти Иакова, а не через 153 года. Разница составляет 260 лет. Правда, здесь уже приводилось разъяснение, что это не 430 лет, как пишет Библия, а 210 лет. Но тогда Исход был через 210-17 = 193 года после смерти Иакова, то есть разница уже 40 лет - с 153 годами, приведенными Вами.

Это я к тому, что есть разные "кластеры" дат, внутри каждого из которых противоречия нет (как и внутри "кластера" приведенных Вами дат), но они, кластеры, между собой обычно не стыкуются.

Но у меня задачи примирения кластеров вовсе нет. Мне такая задача не по плечу. Мне нужно было найти примерные времена, когда жили сыны Иаковы. И у меня получается, что вокруг 3600 лет назад, 1600 лет до нашей эры. С Вашими данными сходится, никакого противоречия. Спасибо, Вы еще более укрепили мою примерную датировку.

Я здесь вчера отметил, что у меня по генеалогическим расчетам (частотам мутаций ДНК) получается, что сыновья Иакова жили 3300 лет назад. Я пересмотрел эти расчеты, и оказалось, что 3600 назад совсем не хуже. Тогда частоты мутаций на маркер получаются 0.0019, а по современным научным данным (по совершенно другой методологии, по парам отец-сын) принята частота мутаций 0.0020 (самые последние данные - 0.001998, с явно завышенной точностью).

Как видите, совпадение вполне поразительное.




Валерия Новодворская
- Sunday, February 25, 2007 at 08:54:13 (PST)

23 февраля. Достать чернил...
Говорят, 23 февраля будет праздник. Аккурат к субботе. Три дня безделья для бездельников – это дар Божий. Советские праздники – это просто поэма; впрочем, как и советские будни. Но советские будни остались за рамками новой, то ли пост-, то ли полусоветской эпохи. А вот праздники были пригреты новым временем и продолжают автоматически отмечаться, хотя их содержание не только не стыкуется с 2007 годом, но даже прямо этому противоречит.

Однако содержание праздника для советского народа никогда не было определяющим, главное было содержание бутылки и наличие закуски. А с этим, как вы понимаете, в советскую эпоху была большая проблема. Сейчас магазины ломятся от самых разных бутылок с приличными этикетками (хотя часть совков осталась верна стеклоочистителю) и невиданных в СССР закусок, поэтому надо быть очень храбрым политиком, чтобы отнять у электората возможность все это употреблять в урочное время.

За 70 лет советской власти граждане привыкли выпивать и закусывать 7 ноября, 1 мая, 23 февраля, 8 марта. У них к этим датам выделяется желудочный сок. И это настолько политически определяющая штука – желудочный сок, что Ельцин тянул с переносом поглощения яств с 7 ноября на что-то другое чуть ли не до отставки. И перенесли-то на такую же никчемную дату, пустой предлог, зато 4 ноября, разница дня всего, сок выделится, но язва желудка образоваться не успеет.

Вот и 23 февраля уцелело ровно по таким же мотивам. Назовите мне другие, пока откупориваете бутылки и делаете винегрет. День рождения армии? Советской? А при чем здесь Советы? Будем отмечать именины той армии, которая под началом Тухачевского травила русских крестьян газами, а их семьи сгоняла в концлагерь, на голодную смерть? Армии, гнавшей штыками невинных людей на Беломорканал, армии карателей и вертухаев, которая только один раз в истории защищала свою землю от иноплеменников, с 1941 года по 1944-й, потому что 1945 год – это уже не освобождение своей России, а завоевание чужой Восточной Европы, включая краденый Кенигсберг (в переводе Жириновских, Путиных и Рогозиных - Калининград).

А что такое у них там в Красной армии случилось 23 февраля? А то, что красные части позорно бежали от немцев. Когда-то российская армия отмечала победы, а не поражения. Может, отдельно отметим заключение позорного Брестского мира, где врагу отдавали огромные части страны, лишь бы большевички остались у власти? Те большевички, которые брали деньги у немецкого генштаба, выкинули лозунг поражения своей страны в войне, расстреливали русских офицеров, вырезали им на плечах погоны и решали путем голосования вопрос, идти ли в атаку. "Мир в обмен на территории" – это они первые придумали.

Мы могли бы отмечать день создания армии Петром I (ну хоть день основания Преображенского полка), день Бородинского сражения, день победы на Куликовом поле, день разгрома гитлеровцев под Москвой, день пленения армии Паулюса под Волгоградом... С желудочным соком не утряслось?

И еще надо разобраться, армия – это что? Пехота, сражавшаяся на "передке", или заградотряды, гнавшие в бой штрафников? Смершевцы – это армия? По-моему, это пятая колонна врага.

Поехали дальше. Может быть, 23 февраля – это день защитника Отечества? Так что будем отмечать в этом контексте? Один защитник отечества без ног и "жизненно важных органов"; другой – без тонкого кишечника; третьего забили насмерть "деды"; четвертый от побоев сам повесился; пятый и шестой бежали и пойманы; седьмой и восьмой расстреляли караул и ушли с оружием, потом окружены и убиты; девятый изнасилован отцами-командирами, а десятого превратили в тупую скотину, унизили, обезличили, лишили чувства самоуважения, запугали на всю жизнь. И таким он вернулся домой. Выпьем за это графинчик очищенной.

А 23 февраля 1944 года – тоже памятная дата. День депортации чеченского народа. Больше трети погибли по дороге, а тех, кто не мог дойти до вагона, запирали в сараи и сжигали заживо. Женщин, детей и стариков. Но маленький Джохар Дудаев выжил. Выжил и вернулся. И сейчас после геноцида кто-то выживет. Вы не боитесь праздновать в этот день на глазах у народа, распятого нами? А если через 50 лет будет еще одна волна – в сторону свободы? Я рада, что у меня не будет внуков, что на них это не падет.

День армии, день защитника отечества… Армии у нас нет. Есть концлагерь, каторжные работы для молодых мужчин. Даже бойня в некотором роде. И вы хотите сказать, что эти зэки будут защищать отечество? Голодные, униженные, измордованные? У нас нет ни армии, ни защитников.

Вопрос в том, кому принадлежит наше Отечество. Наверное, Путину, раз у него такой рейтинг. А нас здесь терпят из милости. А может быть, кто-нибудь считает, что мы отмечаем 23 февраля просто праздник мужчин? Безобидный такой... Должна вас разочаровать: мужчин у нас тоже нет. Кролики, которых можно погнать хоть в Чечню, хоть в "Единую Россию", – не мужчины.

Вот за это и выпьем! Первая – колом, вторая – оглоблей, третья – мачтовой сосной.

22.02.2007 11:13





Алексу.
- Sunday, February 25, 2007 at 08:53:30 (PST)


Что-то начинает казаться, что Вы просто высокомерный болтун.
Читали бы хоть тексты, которые засылаете, - правили бы ошибки.
Иностранными языками в должной мере не владею. Достаточно того, что неплохо знаю русский.
По Вашему совету заглянул в Интернет. Ответ вот какой:

Es wurden keine mit Ihrer Suchanfrage - Спирос Маринатос - übereinstimmenden Dokumente gefunden.

Тартаковский.


К размышлению.
- Sunday, February 25, 2007 at 08:45:37 (PST)


Владимир Вайсберг
- Sunday, February 25, 2007 at 07:25:25 (PST)
Моисей жил 1432 - 1312 гг. до н. э. (Сегодня 7 дня месяца Адар 5767 года - день его рождения и одновременно - день его смерти. Евреи всего мира отмечают сегодня - день рождения величайшего из пророков)
Следовательно Исход из Египта состоялся за 40 лет до его кончины - 1312 плюс 40 равно 1352 год до нашей эры.
А Яаков умер в 1505 г. до н. эры, то - есть за 1505 минус 1352 равно 153 года до Исхода евреев из Египта.

Тартаковский. «Откровение Торы»:
„Год смерти Моисея и перехода евреями Иордана, если по-прежнему доверять Торе, 2488 от Дня Творения - 1272 г. до н.э.
Тогда же ( в пределах десятилетия), если верить современной историографии (и Гомеру), ахейские мужи высадились со своих кораблей в устье небольшой речушки и поныне впадающей в Эгейское море (древнее греческое название - Меандрос, нынешнее турецкое - Малый Мендерес), - и начали осаду крепкостенной Трои...“



Нестор
- Sunday, February 25, 2007 at 08:23:46 (PST)

Proofreader - Saturday, February 24, 2007 at 16:17:59 (PST)
"А я постараюсь пережить зачисление в "некоторые". Ах, да! Еще "огульные и грязные оскорбления".

Увы, до меня слишком поздно дошло, что Вас, Proofreader, задели слова, адресованные мною вовсе не к Вам. Меня даже пот прошиб от Вашей ошибки и, следовательно, напрасной обиды на меня. Недоразумение-с! В любом случае - прошу пардону.
 


В.Ф. - Иону Дегену
- Sunday, February 25, 2007 at 08:16:10 (PST)

С интересом прочитал об Иммануиле Великовском. Каюсь, читал не всё подряд, урывками, перескакивая.(Великоват материал для меня).
Вот два мелких вопроса.
Возможно, из-за невнимательности я пропустил, отчего его имя пишется "Иммануил", а не "Эммануил".
Иммануилом звали, например, Канта, но он был немец. У евреев чаще встречается Эммануил (Эмануил).
Там упоминается ещё учёный Шаефер, швейцарец. Скорее всего, он немецкий швейцарец, судя по фамилии, что неудивительно, ибо у 75% швейцарцев родной язык немецкий.
Если так, то его фамилия Schaefer читается как Schäfer, ибо по-немецки ä=ae (со времён Мартина Лютера). Тогда по-русски будет произноситься Шефер, а не Шаефер.


Verdict
- Sunday, February 25, 2007 at 08:00:37 (PST)

Proofreader - Saturday, February 24, 2007 at 16:17:59
А ты, Вердикт, молчи, как обещал

А я и молчу. Как обещал.
Наблюдателем тебя исключительно заради заделался.
А Авигдор оказывается Нестора защищает. Это от тебя-то. Cirque du Soleil - Одно слово (или два с артиклем :))). Банальность скажу: и умным людям случается попадать в дурацкие ситуации.

Лады, дальше поехали.

Модератору: не могу запостить английский текст, обращенный к потребителям бензина (это про Чавеса).


Alex
- Sunday, February 25, 2007 at 07:55:00 (PST)

Есаул, именно я..;-) Что делать, если у меня богатая биография!?;-))Более того скажу - до сих пор балдею, когда слышу Air, впервые услышал под Файзабадом, крутил рацию и поймал..Слышал и исполнение 5-го концерта Бетховена Вашим отцом. дирижировал Д.Ойстрах (кстати, плохо). Так что я не прост..;-))

Тартаковскому; мне лень рыться в интеренете, честно говоря и времени и желания нет. В СССР по этому поводу выходила книжка - Резанов. Атлантида - миф или реальность. Там большая библилграфия. Еще я читал несколько книг на немецком об этом.. Уже не помню, как назывались. Лет 5 назад читал в Германии об отождествлении Трои и Атлантиды. В Штуттгарте была выставка о Трое (не ходил, но просматривал каталог). Наберите Спирос Мрмнатос (или Spiros Marinatos) и получите миллион сылок. Все эти теории о совпадении Мсхода со взрывом Санторина не новы!


Галесник Марк: Третья мировая
- Sunday, February 25, 2007 at 07:44:30 (PST)

Очередная Третья мировая едва не разгорелась из-за очередных происков евреев, покусившихся на мусульманскую святыню – мечеть Аль-Акса. Попытка покушения была предпринята методом ремонта моста, по которому туристы поднимаются на Храмовую гору, где эта мечеть размещена.

Какой ущерб этот мост, эти туристы и эти евреи наносят мечети, не разъясняется. Да этого и не нужно для провозглашения очередного джихада.

Предыдущий, как помнится, был объявлен в 2000 году после восхождения на Храмовую гору Ариэля Шарона, и получил название «интифада Аль-Акса». То обстоятельство, что сюда ежедневно поднимаются сотни евреев туристического происхождения, не помешало палестинцам встать на защиту неизвестно чего от известно кого. Именно тогда, 28 сентября 2000 года, стала очевидной недопустимость этого безобразия, продолжающегося уже 3000 лет.

Первый храм был построен на этой горе небезызвестным царем Соломоном еще в 9 веке до н. э. - специально, чтобы досадить палестинцам. К счастью, он простоял считанные столетия и в 586 г. до н. э. был разрушен борцом за права палестинского народа царем Навуходоносором. Евреев сослали в Вавилон, откуда, впрочем, они скоро вернулись и отстроили Второй храм. Этот продержался уже до 70 года н. э. и его разрушил другой защитник палестинцев - римский император Тит.

Евреи отправились кто куда, отложив строительство Третьего храма на неопределенный срок, а к моменту их возвращения стройплощадка оказалась занята – на ней в конце 7 века начали воздвигать святыни новой религии. Те самые, мостик к которым на днях чуть не стал причиной Третьей мировой войны.

Если история Первого и Второго храмов досконально описана в многочисленных религиозных и исторических источниках, то мечеть Аль-Акса упомянута только один раз – в 17 суре Корана. Впрочем, Иерусалим как место ее дислокации, не упомянут даже в этом уважаемом источнике.

Некоторые мусульманские богословы даже считают, что располагалась эта мечеть непоредственно на небесах, куда пророк Мухаммед в начале 7 века вознесся на коне с человеческим лицом Эль-Бараке, однофамильце будущего премьер-министра Израиля.

При котором, кстати, и началась пресловутая интифада. При министре, разумеется, а не при коне.

Вот на этом самом месте на Храмовой горе, с которого Мухаммед стартовал, и построена мечеть, правда, не Аль-Акса, а Куббат ас-Сахра (Купол над скалой), а уж неподалеку от нее и Аль-Акса, на которую теперь покушаются неверные. И которую так страстно защищают от них палестинцы, нарушая при этом ценную рекомендацию, заповеданную им в 36 стихе все той же 17 суры: «Не следуй тому, чего ты не знаешь».

Утверждается, кстати, что сказав «Поехали!», пророк обронил на космодроме три волоска из своей бороды, которая неопровержимо свидетельствует в пользу почвенной теории происхождения третьей по значимости святыни ислама.

Выйдя на орбиту, Мухаммед помолился вместе с Мусой (Моисеем), Ибрагимом (Авраамом), Исой (Иисусом) и другими официальными ликами. После чего возвратился на землю, дабы продолжить насажденье единственно правильной веры.

…В разгар краеведческих исследований ко мне в офис заглянул Ахмед - палестинец из соседней деревни, обходивший еврейские окрестности в поисках работы. Удостоверившись, что в саду ничего делать не надо, он собрался было уходить, но вдруг увидел у меня на столе Коран, подаренный коллегами-саудовцами на Московской книжной ярмарке.

Ахмед очень удивился и осторожно поинтересовался что нового. Я вкратце пересказал ему некоторые события из истории, предшествовавшей появлению ислама. Ахмед ласково улыбнулся, положил мне руку на плечо и спросил:

– Господин мой, кто вложил в голову твою глупости эти?
(Перевод с иврита.)

…Помнится, статью я начинал писать, предполагая проанализировать истинные причины беспорядков вокруг Храмовой горы, угрожающих перерасти в мировую войну. Но как-то совершенно забыл, что хотел сказать. Просто вылетело из головы, да и все тут. Бывает. Проанализирую как-нибудь в другой раз. Когда очередная мировая начнется.

Copyright ©2007 smile.media

http://www.mnenia.zahav.ru/ArticlePage.aspx?articleID=1989


Владимир Вайсберг
- Sunday, February 25, 2007 at 07:25:25 (PST)

АК
Не вдаваясь в суть Ваших рассуждений, приведу еще несколько дат из той - же книги "Иудаизм - еврейский образ жизни" Арье Кармеля.
Моисей жил 1432 - 1312 гг. до н. э. (Сегодня 7 дня месяца Адар 5767 года - день его рождения и одновременно - день его смерти. Евреи всего мира отмечают сегодня - день рождения величайшего из пророков)
Следовательно Исход из Египта состоялся за 40 лет до его кончины - 1312 плюс 40 равно 1352 год до нашей эры.
А Яаков умер в 1505 г. до н. эры, то - есть за 1505 минус 1352 равно 153 года до Исхода евреев из Египта. В ЧЕМ ПРОТИВОРЕЧИЕ?
Прошу прощения за вмешательство. Всего доброго!


Есаул
- Sunday, February 25, 2007 at 07:09:18 (PST)

Alex, неужели это Вы здесь несколько лет назад так здраво рассуждали о концертах Бетховена в исполнении Керера? Тогда Матроскина тут еще не было, а я выступал под ником Генералиссимус. Я почему-то уверен, что это был другой Алекс...


М.Тартаковский.
- Sunday, February 25, 2007 at 07:09:00 (PST)


AK
Boston, MA - Sunday, February 25, 2007 at 05:32:16 (PST)
Кстати, о возможном извержении вулкана для объяснения египетских несчастий писал и Маркс Тартаковский в своем труде "Откровение Торы", правда, без конкретного наименования вулкана.


>>>>>>>>>>>>>>>>>>MCN<<<<<<<<<<<<<<<<<
"...Погублено все это не жестоким нашествием или поголовным мором, но грозным природным катаклизмом - не просто извержением, но прямо-таки взрывом вулкана, на месте которого в архипелаге Киклады остался лишь подковообразный островок Тира.... /"Откровение..."/

Ув. Анатолий, добавлю только: за полторы тысячи лет до н.э. сам вулкан не имел названия. Нет его и по сей день – как нет уже самого вулкана.
Санторин – позднейшее, христианское название о-ва.
Неподалёку – на островке Каймени есть действующий вулкан. Называется соответственно названию о-ва.

+++++++++++++++++++++++++++++

Alex
- Sunday, February 25, 2007 at 06:13:45 (PST)
Tartakowski, у Вас комплекс превосходства - об извержении Санторина написаны сотни книг и еще до ВМВ была выдвинута гипотеза об Атлантиде на о.Санторин. Слышали про Спироса Маринатоса? Лучше бы ссылку на него дали
.

>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<

Горячитесь. Это несолидно. Конечно, остров Тира - характерной для вулканического жерла, затопленного морем, подковообразной формы – и об этом прекрасно знали.
Раскопки на территории древней Спарты в культурных горизонтах, образованных ДО взрыва и ПОСЛЕ предлагают совершенно разные культуры.
Даже не верилось, что – те же «спартанцы».
То же и в Микенах...

Но если Вы где-то прочти О СВЯЗИ между этим взрывом и событиями в Восточном Средиземноморье – приведите текст. Хотя бы вкратце с указанием источника. Буду чрезвычайно благодарен.

Насчёт комплекса. Не переношу НАГЛЫХ плагиаторов. /К скромным – другое отношение/. У Вас другие правила?

И ещё. Не козыряйте юдофобией. Присмотритесь: русские «патриоты» выглядят не лучше еврейских. «Христос – славянин» «Пращурам русов – 12 тысяч лет» т.п.
Почитайте Мухина, Платонова /другого/ и пр. Таких ныне "тьма и тьма".



Alex
- Sunday, February 25, 2007 at 06:13:45 (PST)

Tartakowski, у Вас комплекс превосходства - об извержении Санторина написаны сотни книг и еще до ВМВ была выдвинута гипотеза об Атлантиде на о.Санторин. Слышали про Спироса Маринатоса? Лучше бы ссылку на него дали. Мли языками не владеете? У Вас уровень как у некоего грузчика Макаровского - у того другая ide fix: Мицкевич - еврей, а Пушкин тем более..

Другому анониму; почему солдафон не может иметь хобби!? ;-)) Просто я в свое время хорошо учился и много успел узнать, в то время когда ты страдал 'в душной атмосфере совка '. К сожалению, приходится содержать быдло вроде инвалида Матроскина.Но этот скоро свое получит, не беспокойся..


AK
Boston, MA - Sunday, February 25, 2007 at 05:32:16 (PST)

>Матроскин, Sunday, February 25, 2007 at 03:10:26 (PST)
>И только вчера я случайно наткнулся на упоминание о редчайшем (не чаще одного раза в 5000 лет) катастрофическом взрыве вулкана Санторино в Эгейском море.
>...Минойское извержение вулкана Тэра (Thera/ Santorino) в Эгейском море в бронзовом веке датируется радиоуглеродным способом 1639-1616 годами до н.э., дендрологическим способом – 1628 годом до н.э., археологическим способом – 1530 – 1500 годами до н.э.
>Так что наиболее вероятная дата Исхода из Египта 1628 год до н.э. плюс несколько лет.
#####################

Уважаемый Матроскин,

Это замечательные данные, спасибо. Кстати, о возможном извержении вулкана для объяснения египетских несчастий писал и Маркс Тартаковский в своем труде "Откровение Торы", правда, без конкретного наименования вулкана.

Дата 1628 год до н.э. как прешествующая исходу - весьма неортодоксальная, и ломает другие довольно устоявшиеся (если там есть что-то устоявшееся) оценки. Например,
Владимир Вайсберг (Friday, February 23, 2007 at 07:37:43) отметил, что в хронологической таблице, приведенной в книге Арье Кармеля, время жизни Яакова 1652- 1505 до н. э. Это означает, что перед исходом из Египта Иакову было всего 24 года, что сильно не стыкуется.

Далее, Altair приводил данные, что it was Moses who first recorded the Torah in 1,400 B.C.E. Здесь, наоборот, что Тора была вручена Моисею через двести с лишним лет после Исхода, что тоже не очень стыкуется.

Приведенные Вами археологические данные об извержении вулкана в 1500-1530 гг до н.э. лучше стыкуются с годами жизни Иакова, но все равно получается, что он умер за 5 лет до Исхода, или даже через 25 лет после.

Иначе говоря, пусть с этим новым (для меня) обстоятельством работают специалисты. Я пока взял даты жизни сыновей Иакова вокруг 3600 лет назад (вокруг 1600 лет до н.э.). То есть и Иакову был полтинник по хронологическим таблицам, и от вулкана на круг недалеко. И Моисею Тору через 200 лет вручили. А у меня в любом случае генеалогическая подвижка практически незаметна, по прошествии более трех тысячелетий.

В любом случае - спасибо.


М.Тартаковский.
- Sunday, February 25, 2007 at 05:09:00 (PST)


Матроскин
- Sunday, February 25, 2007 at 03:10:26 (PST)
...Периодические поиски в течение года следов подобного извержения в интервале времени возможного Исхода оказались безрезультатными. И только вчера я случайно наткнулся на упоминание о редчайшем (не чаще одного раза в 5000 лет) катастрофическом взрыве вулкана Санторино в Эгейском море...

>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<

Когда два дня назад я написал: «Неуловимый Джо попрежнему рядом. Всегда при ноге», - и совершил ошибку.
Приношу извинения. Так по-русски не говорят. Правильно так: «Неуловимый Джо всегда У ноги».
Вот и сейчас тоже.

М. Тартаковский. Откровение Торы /«Заметки» №№ 3 и 4/
«... Произведя элементарный подсчет (суммируя сроки, отпущенные предшествовавшим поколениям), узнаем, что великий Исход из Египта под предводительством Моисея свершился в 2398 году от Дня Творения (1362 г. до н.э.). Примерно ту же дату предлагает нам и современная историческая наука.

Момент этот был судьбоносным не только для народа Израиля, но и для всего Восточного Средиземноморья (и, значит, для мировой истории). Как-то в одночасье рухнули цветущие цивилизации Крита и Микен; на обычно скудной в археологическом отношении земле классической Спарты, именно в пласте, датированном вышеупомянутом временем, обнаруживается росписная керамика, изящные украшения и многие другие свидетельства исчезнувшей яркой жизни...

Современные историки все более склоняются к мнению, что погублено все это не жестоким нашествием или поголовным мором, но грозным природным катаклизмом - не просто извержением, но прямо-таки взрывом вулкана, на месте которого в архипелаге Киклады остался лишь подковообразный островок Тира. Взрыв этот (подобный, вероятно, взрыву в 1883 году вулкана Кракатау между Суматрой и Явой) вызвал ужасное землетрясение и морские волны необычайной высоты: при накате цунами на берег приливная волна превышала порой 50 метров. Прибрежные города были попросту смыты ею и вмиг обезлюдели.

Не эта ли волна, накатываясь на другие берега, обнажила морское дно, как о том свидетельствует Тора в описании бегства евреев из Египта? А "тьма на земле Египетской, осязаемая (!) тьма" (И. 10\21), длившаяся три дня, - не оттого же? Взрыв Кракатау, уже на памяти современной науки, сопровождался выпадением вулканического пепла на площади почти миллиона квадратных километров. В донесениях голландских колониальных властей из Батавии (нынешняя Джакарта) употреблено было как раз это выражение: "тьма египетская"...

Конечно, буквальное совпадение двух уникальных событий - Исхода евреев и вулканического взрыва - чрезвычайно маловероятно. Такового - день в день - скорее всего не было. Просто, в памяти народа оба события, близкие во времени, наложились одно на другое...»

Гораздо подробнее о том же в моей «Историософии» /М. 1993/; ещё подробнее – М. Т. «На весах столетий» //«Проблемы Дальнего Востока», М. АН СССР, №№ 6\89 – 2\90//

К вопросу: почему матроскины не открыли Америку - и никогда не откроют.
Жила тонка.
Надеюсь, грамматически верно?


Михаил Лезинский
Хайфа, Израиль - Sunday, February 25, 2007 at 04:05:34 (PST)

Ион Деген
- Saturday, February 24, 2007 at 15:31:04 (PST)
...позвонил мне Фёдор Родионович Богданов, член-корр Академии Медицинских Наук.
- Ион Лазаревич, вы читали сегодня «Комсомольскуп правду»?
- Я «Комсомольскую правду» не читаю.
- Вы знали Доватора?
- Его знала вся страна.
- Нет, я имею в виду лично.
- Нет.
- Вот послушайте, что тут написано. «Кто видел генерала Доватора в седле, мог подумать, что он донской или кубанский козак. А между тем, генерал Доватор был сыном белорусского народа». Он был моим пациентом. Я этого сына белорусского народа видел без штанов. Да он и не скрывал того, что он еврей...
+++
Родной брат моего отца ( ныне - покойный ) Роман Самойлович Лезинский служил в кавалерийском полку Доватора ...


Матроскин (дополнение)
- Sunday, February 25, 2007 at 03:49:11 (PST)

Положеие Санторино в Эгейском море, схема вулкана:
http://www.geology.sdsu.edu/how_volcanoes_work/Images/Diagrams/Santorini%20maps.jpg


Матроскин
- Sunday, February 25, 2007 at 03:10:26 (PST)

И наслал Всевышний страшные казни на египтян за упрямство их царя-фараона. Сначала превратились воды реки Нил в кровь, и не смогли люди больше брать воду из этой реки.
Второе наказание - всю землю заполнили жабы, лягушки.
Третье наказание - заели людей вши и мошки.
Четвертое наказание - напали на египтян дикие звери: тигры, львы, крокодилы. И не было от них спасения.
Но продолжает упрямиться фараон, не отпускает Сынов Израиля из Египта. И тогда наслал Всевышний пятую казнь - мор на домашних животных. Стали умирать коровы, овцы, козы.
А шестая казнь была ещё более неприятной: появились нарывы и раны на телах людей, и люди очень от них страдали.
Седьмой и восьмой казнями оставил Всевышний жителей Египта голодными, потому что крупный град побил все растения, а полчища саранчи съели весь урожай на полях.
И плакали египтяне и не могли они найти дорогу к своим домам и видеть друг друга, потому что девятой казнью была беспросветная тьма, покрывшая всю землю египетскую.
Но чем больше свершалось казней, тем больше упрямился жестокий и злой фараон. И тогда Всевышний наслал самую страшную казнь - он поразил всех первенцев. Стали умирать сыновья, родившиеся первыми в семьях египтян и первенцы животных, принадлежащих египтянам, но дома евреев эта страшная казнь обошла. (Мы уже знаем, что на иврите "обход" называется Песах). И только когда у самого фараона умер его Сын - первенец, он разрешил евреям быстро (с поспешностью) уйти из его страны.

Исходя из логической посылки, что в основе любой легенды лежит некое событие, с течением времени обрастающее фантастическими подробностями, можно попытаться сформулировать и найти это событие или хотя бы его следы.

Что имеется в сухом остатке от описания Египетских Казней? Изменение цвета стока Нила, падение с неба жаб и лягушек, необычное поведение животных, птиц и насекомых, массовые накожные заболевания, внезапная беспросветная тьма, страшный голод.

Не слишком сложно привязать все эти события к единственному возможному событию: последствиям сильного извержения вулкана с выбросом большого объема пепла и сернистых газов, повлекшее климатические изменения и кислотные дожди.

Периодические поиски в течение года следов подобного извержения в интервале времени возможного Исхода оказались безрезультатными. И только вчера я случайно наткнулся на упоминание о редчайшем (не чаще одного раза в 5000 лет) катастрофическом взрыве вулкана Санторино в Эгейском море.

Попутно выяснилось, что эта плодотворная идея давно приходила в головы ученых. Приятно сознавать, что все новое – это хорошо забытое старое. Дальнейшие ссылки и цитаты из англоязычных материалов с моим переводом (предупреждаю, качество перевода далеко не академическое).

Итак, Минойское извержение вулкана Тэра (Thera/ Santorino) в Эгейском море в бронзовом веке датируется радиоуглеродным способом 1639-1616 годами до н.э., дендрологическим способом – 1628 годом до н.э., археологическим способом – 1530 – 1500 годами до н.э. Во время извержения было выброшено в высокие слои атмосферы до 60 (!) кубических километров пепла и сернистых газов. Это привело к очень сильным климатическим изменениям на всей земле, и особенно в регионе Средиземного моря. Огромные цунами, сопровождавшие взрыв Санторино, по мнению ученых привели к гибели минойскую цивилизацию с центром на острове Крит, из-за чего это извержение получило название «Минойское извержение».

Подобные катастрофические извержения случаются не чаще, чем один раз в 5000 лет. Результатами подобного катаклизма являются сильнейшие землетрясения, цунами, выпадение многометровых слоев пепла, кислотные дожди, длительное снижение солнечной радиации почти до нуля с резким снижением температуры – «вулканическая зима».

Наиболее точный способ датировки подобных катаклизмов – дендологический, поскольку знаменитые американские секвойи живут до 4000 лет. Так что наиболее вероятная дата Исхода из Египта 1628 год до н.э. плюс несколько лет.

Кальдера вулкана: http://upload.wikimedia.org/wikipedia/commons/1/14/Santorini_Landsat.jpg



М.Тартаковский.
- Sunday, February 25, 2007 at 02:39:23 (PST)


Ион Деген
- Saturday, February 24, 2007 at 15:31:04 (PST)
...позвонил мне Фёдор Родионович Богданов, член-корр Академии Медицинских Наук.
- Ион Лазаревич, вы читали сегодня «Комсомольскуп правду»?
- Я «Комсомольскую правду» не читаю.
- Вы знали Доватора?
- Его знала вся страна.
- Нет, я имею в виду лично.
- Нет.
- Вот послушайте, что тут написано. «Кто видел генерала Доватора в седле, мог подумать, что он донской или кубанский козак. А между тем, генерал Доватор был сыном белорусского народа». Он был моим пациентом. Я этого сына белорусского народа видел без штанов. Да он и не скрывал того, что он еврей...

>>>>>>>>>>>>>>>>>>>>>>>>>>>MCT<<<<<<<<<<<<<<<<<<<<<<<<

Многоуважаемый господин Деген!
Очень не хотелось бы, чтобы Ваше справедливое замечание о хамском, беспардонном, издевательском – притом публичном! – выпендривании двух пошлых фигурантов свелось к тому, еврей ли Лев Михайлович Доватор или не еврей.

Само появление этих хамов на божий свет стопроцентно обеспечено тем, что в решающей /на столетия вперёд/ войне победили Вы и такие, как Вы, - евреи ли или «гои».

Хамство вызвало законную реакцию некоего Алекса – вероятно, юдофоба, но от того не менее справедливого в данном вопросе. Вполне может начистить физиономию Матроскину – что в данном случае будет не только справедливым, но и не каралось бы по законам Германии.

Даже здесь, в поверженной стране, чтят – во всяком случае, официально – ВАШ подвиг. /В отличие от прибалтов, получивших национальное самоопределение по воле Сталина /да, тирана и сукина сына!/ и государственность – по снисхождению России/.

Л. М. Доватор со своим кавалерийским корпусом прошёл по тылам гитлеровцев в решающие недели зимы 41-го – и погиб тогда же и там. Мой отец знал, что Доватор – еврей. Но поинтересовался с присущим ему местечковым юмором: «Это ли важно?»

Сама фамилия встречается у черноморских греков. Почти забытый представитель петербургской школы историко-классической филологии, антиковед, специалист по творчеству Геродота, Аристотеля, Феогнида, Динарха, Диогена Лаэртия, эпиграфики античных городов Причерноморья и т.д. и т.п. Аристид Иванович ДоватУр родился в г. Рени Бессарабской губернии и был греком. /А. Солженицын настаивает на том, что был он «румыно-французского происхождения», но это ошибка/.
Я это не к восславлению забытого эллиниста, - но к прояснению происхождения ныне редкой фамилии.

Славе Льва Михайловича Доватора, героя Второй мировой, псевдоинтеллектуальная шваль никак не повредит.



ЦАХАЛ готовится
- Sunday, February 25, 2007 at 02:38:57 (PST)

Впервые за 6 лет все десантные бригады ЦАХАЛа провели масштабные военные учения с участием ВВС, артиллерии, бронетехники и техкорпуса

Начальник генерального штаба ЦАХАЛа Габи Ашкенази прибыл на Голанские высоты, где будет наблюдать за учениями десантных бригад. Отмечается также, что Ашкенази считает своей основной задачей повышение уровня боевой подготовки армии. (Источник: Курсор).
За маневрами наблюдали также начальник генштаба генерал-лейтенант Габи Ашкенази, командующий Северным округом генерал-майор Гади Айзенкот и министр обороны Амир Перец. Габи Ашкенази сообщил журналистам, что ливанская шиитская террористическая организация "Хизбалла" все еще не восстановила свои силы. Он подчеркнул, что террористы лишились опорных пунктов вдоль границы с Израилем, а также не имеют более свободы передвижения на территории к югу от реки Литани. "Террористы пытаются восстановить свой военный потенциал, особенно арсенал тактических ракет относительно большого радиуса действия", – добавил он. Слова Ашкенази противоречат заявлению представителя военной разведки генерала Йоси Байдаца, который заявил вчера, что "Хизбалла" восстановила свою мощь в полном объеме. Министр обороны Амир Перец счел нужным сообщить, что проведение учений на Голанских высот не свидетельствует о подготовке войны с Сирией. "Мы должны быть готовы к любому возможному сценарию", – добавил он. (Источник: NEWSru.il).
ИА MIGnews приводит такие подробности: "Впервые за последние шесть лет все десантные бригады ЦАХАЛа провели масштабные военные учения. Учения проводились при поддержке ВВС, артиллерии, бронетехники и технического корпуса. Десантные бригады выполняли задачи, основанные на уроках, извлеченных из Второй ливанской войны. Один из офицеров сказал агентству Ynet, что учения проводятся в жестких условиях для повышения боеготовности младшего офицерского состава и солдат, которые никогда не участвовали в крупномасштабных учебных боях. Высокопоставленные офицеры запаса, которые командовали войсками в последней ливанской войне, принимали участие в учениях".
Как сообщает ИА "Седьмой канал" подготовка ЦАХАЛа идет не только в Северном , но и в Южном округе. «Джерузалем пост» сообщила вчера, что ЦАХАЛ построил точную имитацию «арабского города», в котором будут тренироваться солдаты боевых соединений для обретения навыка военных действий в районах городской застройки - в рамках подготовки к будущей войне. По утверждению военного командования, учебный городок был запланирован еще 8 лет назад, а строительство его началось год назад, и никак не связано с летней войной в Ливане, в которую, как известно, были брошены солдаты боевых частей армии, готовившиеся на протяжении последних полутора лет к борьбе не с внешним врагом, а с поселенцами, ввиду планировавшейся программы «свертывания». Начавшиеся тренировки предусматривают пропускную способность тренировочного городка два батальона в неделю. Тренировочный городок расположен на территории южной военной базы Цеелим. Издали он выглядит в точности как настоящий арабский город. Около 500 строений предусматривают максимальное число жителей 5000. «Как в каждом настоящем городе, мы построили мечети, Касбу и даже лагерь беженцев», рассказал корреспонденту газеты майор Арик Море, заместитель командира «Города тактического обучения», как он официально называется, после утренних учений в минувший понедельник. На фоне на протяжении всего времени учений постоянно слышится арабская музыка – для создания нужного настроения у солдат. В центре некоторых домов зияют дыры – имитация тех, что проделывают солдаты, когда они врываются в дом в ходе военных действий и захватывают его. «Это место было построено с максимальным приближением к реальности. Тесно стоящие дома, магазины, центральная площадь», говорит Море, добавляя, что в учениях принимали участие в основном слушатели командирских курсов. В ходе учения порядка 350 солдат были сосредоточены в модели города, некоторые из них исполняли роли гражданских лиц, а несколько женщин, одетые в американские униформы и вооруженные винтовками с лазерным наведением, изображали боевиков «Хизбаллы». «Это обычное разделение», рассказали две женщины после демонстрации операции, в ходе которой солдаты ворвались в дом – конечно, успешно. «Главная сложность такого городского боя заключается в том, чтобы не выпускать из виду каждого бойца, не терять его место нахождения, потому что как только солдаты входят в такой город, они исчезают в домах и становятся невидимыми», говорит Море. По словам армейских специалистов, моделью при постройке города служили многие арабские города, но в основном Рамалла. Каждый дом оборудован аппаратурой для наблюдения, и камеры начинают снимать, как только солдаты входят внутрь, для последующего разбора. Все боевые подразделения пройдут тренировки на базе этого городка, в том числе и ВВС, специальные десантные подразделения собаководов, чиновники военной администрации и представители прессы. Бригадный генерал Узи Москович, начальник тренировочного городка, сказал, что это крупнейшая в мире тренировочная база такого рода. Она занимает территорию в 20 кв. км. Записи кинокамер позволят сделать оптимальные выводы из проведенных учений. Некоторые части городка еще находятся в стадии завершения и будут готовы лишь в июле 2007 г. Здесь будут проходить учения не только солдаты срочной службы, но и резервисты, которые будут отрабатывать все возможные варианты городского боя, от похищения до различных террористических действий и засад. По словам Московича, учеба это постепенный процесс, и все виды войск будут учиться взаимодействию. Он также сказал, что в будущем ЦАХАЛ будет привозить сюда гостей из иностранных армий. Хотя другие утверждают, что учебный городок планировался еще восемь лет назад, Москович говорит, что «такого радо массовые учения в условиях приближенных к реальным являются уроком последней войны. По словам Московича, проблемы деморализации солдат в армии нет. «Общее настроение таково, что мы допустили некоторые ошибки, которые следует принять во внимание, но в целом атмосфера хорошая». Этому противоречат высказывания двоих солдат-десантников, которые принимали участие в учениях. В качестве резервистов они участвовали в войне, и они сказали, что проблема в ходе Ливанской войны заключалась в поведении политического руководства. «Нет сведений относительно войны в скором будущем, но мы живем в таком нестабильном районе, что армия должна быть всегда в максимальной готовности», сказал Москович. После красочной симуляции боя для гостей-журналистов лейтенант Эфи сказал, что основная разница между учениями в городке и реальной боевой ситуацией заключается в амуниции. Он также сказал, что здесь отсутствует фактор страха, потому что это только симуляция. Но это помогает улучшить наши боевые возможности. «Это более точный инструмент для нашего обучения, и мы надеемся, что будем действовать лучше» в следующей войне.
(Источники: Курсор, NEWSru.il, MIGnews и Седьмой канал).
 


Войны - 2007
- Sunday, February 25, 2007 at 01:59:24 (PST)

В начале 2007 года, по данным Центра Оборонной Информации\Center for Defense Information, в мире протекало 15 крупных вооруженных конфликтов - столько же, сколько в прошлом году, и на 8 меньше, чем в 2005. Крупным конфликт считается в том случае, если было зафиксировано более 1 тыс. жертв, включая военных и гражданских лиц. Кроме того, в мире существует 21 "горячая точка" - при определенном развитии событий эти очаги напряженности могут дать начало новым войнам.
На сегодняшний момент в мире не ведется традиционной, конвенциональной войны, в которой противниками являются регулярные армии. Борьба протекает между государствами и инсургентами, которые преследуют различные цели. Однако увеличилось количество внутренних конфликтов, в которые вмешиваются вооруженные силы иных государств.
Более трети всех конфликтов протекает в Африке, в Азии насчитывается четыре конфликта, в Латинской Америке и на Ближнем Востоке - по два, в Европе - один (Чечня). С учетом глобальной войны с террором, которую ведут Соединенные Штаты и их союзники, количество конфликтов достигает 15-ти.
В 2006 году несколько гражданских войн перешли на более высокий уровень и превратились в региональные вооруженные конфликты. Так произошло в Судане, где на протяжении последних лет воевали милиции, образованные арабами (при поддержке государства) и чернокожими. Этот конфликт привел к началу военных действий в соседнем Чаде и Центрально-Африканской Республике. Угандийские и руандийские повстанцы продолжают использовать южный Судан и восточную часть Демократической Республики Конго в качестве своей базы. Израильско-палестинский конфликт переместился на территорию соседнего Ливана, где Израиль атаковал позиции террористической организации "Хезболла". Гражданская война в Сомали прекратилась (возможно, временно) после интервенции Эфиопии.
В 2006 году мирно завершился конфликт между правительством Непала и инсургентами-маоистами, который начался в 1986 году и имеет идеологические причины. Мир был достигнут при международном посредничестве.



Израиль — в числе основных стран-доноров
- Sunday, February 25, 2007 at 01:54:55 (PST)



Организация Экономического Сотрудничества и Развития (ОЭСР), которая объединяет 22 индустриально развитые страны мира, опубликовала доклад о размерах помощи, которую эти страны предоставляют «бедным» государствам, международным структурам и гуманитарным агентствам.

В 2005 году члены Организации передали развивающимся странам почти 107 млрд. долларов, сообщает WashingtonProfile. Страны не входящие в эту структуру, ассигновали на эти цели 3.2 млрд. долларов (из них 1.7 млрд. выделила Саудовская Аравия, в число крупнейших доноров также вошли Кувейт, ОАЭ, Израиль и Тайвань).

Наиболее щедрым, по объемам помощи (учитывались гранты, дотации, списывание долгов и т.п.), государством стали США, которые ассигновали на эти цели более 27.6 млрд. долларов. В первую пятерку крупнейших спонсоров также входят Япония (примерно $13.1 млрд.), Великобритания (почти 10.8 млрд.), Германия и Франция (каждая — чуть более $10 млрд.). Размеры взносов иных стран заметно меньше.

По иному показателю — доле валового внутреннего продукта, расходуемого на эти цели — безоговорочными лидерами являются Швеция и Норвегия, которые тратят 0.94% своего ВВП. Для Нидерландов и Люксембурга этот показатель равен 0.82%, для Дании — 0.81%. США здесь находятся на третьем с конца месте (0.22%).

В среднем члены ОЭСР расходуют на помощь иным государствам 0.47% ВВП (в 1994-1995-е годы он был рекордно высоким — 0.78%), но ООН считает эту помощь недостаточной и рекомендует развитым странам тратить на экономическую помощь 0.7% своего ВВП.

Государства бывшего СССР в 2005 году получили достаточно заметную внешнюю поддержку. Армения получила 193 млн. долларов, Азербайджан — 223 млн., Грузия — 310 млн., Казахстан — 229 млн., Кыргызстан — 268 млн., Таджикистан — 241 млн., Туркменистан — 28 млн., Узбекистан — 172 млн., Беларусь — 58 млн., Украина — 410 млн., Молдова — 192 млн. долларов.

Иностранная помощь имеет наибольшее значение для Кыргызстана, где она составляет 11.37% ВВП. На втором месте по этому показателю Таджикистан (10.79%), на третьем — Молдова (5.85%).

Рекордную по размерам помощь в 2005 году получили Ирак (12.9 млрд. долларов) и Нигерия (3.2 млрд.). В некоторых странах иностранная помощь обеспечила более половины ВВП — такая ситуация сложилась, например, в Либерии, Сант-Томе и Принсипи и Соломоновых островах. Любопытно, что если размеры внешней помощи значительны, то правительства этих государств хуже управляют государственным бюджетом и хуже собирают налоги.

Источник: JNews



Десять самых богатых россиян по версии журнала "Финанс"
- Sunday, February 25, 2007 at 01:45:49 (PST)

Олег Дерипаска - 563,5 миллиарда рублей
Роман Абрамович - 558,2
Михаил Прохоров - 377,4
Владимир Потанин - 377,4
Владимир Лисин - 369,5
Михаил Фридман - 368,1
Вагит Алекперов - 326,9
Сулейман Керимов - 321,6
Алексей Мордашов - 299,0
Виктор Вексельберг - 297,7

12.02.2007



Внимательный читатель-Игреку
- Sunday, February 25, 2007 at 01:34:01 (PST)

Предлагаю объяснить это участникам "схватки" в отдельном эссе. А?


А что А? Ваша фраза двусмысленна. Вы предлагаете участникам, чтобы они объяснили это в отдельном эссе? Маловероятно надеяться на результат. Или Вы предлагаете написать эссе, объясняющее участникам "схватки" "это". Это похвально и интересно, но как Вы это напишете, если не в курсе дела? Темна украинская ночь...







Rambler's Top100